Transcript: Human NM_001307945.2

Homo sapiens cholinergic receptor nicotinic alpha 5 subunit (CHRNA5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CHRNA5 (1138)
Length:
2836
CDS:
201..683

Additional Resources:

NCBI RefSeq record:
NM_001307945.2
NBCI Gene record:
CHRNA5 (1138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061137 CCAGGTTCTTGATCGGATGTT pLKO.1 685 3UTR 100% 4.950 6.930 N CHRNA5 n/a
2 TRCN0000061134 CCTGATGACTATGGTGGAATA pLKO.1 534 CDS 100% 10.800 7.560 N CHRNA5 n/a
3 TRCN0000291203 CCTGATGACTATGGTGGAATA pLKO_005 534 CDS 100% 10.800 7.560 N CHRNA5 n/a
4 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1345 3UTR 100% 4.950 2.475 Y CFLAR n/a
5 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1345 3UTR 100% 4.950 2.475 Y C19orf31 n/a
6 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1343 3UTR 100% 4.950 2.475 Y ERN2 n/a
7 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1343 3UTR 100% 4.950 2.475 Y P3H4 n/a
8 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1343 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2149 3UTR 100% 4.950 2.475 Y DCAF11 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2049 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.