Transcript: Human NM_001308014.2

Homo sapiens solute carrier organic anion transporter family member 6A1 (SLCO6A1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLCO6A1 (133482)
Length:
1871
CDS:
158..1558

Additional Resources:

NCBI RefSeq record:
NM_001308014.2
NBCI Gene record:
SLCO6A1 (133482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038290 CCCAGATGTAACTGTGAAGAA pLKO.1 1501 CDS 100% 4.950 3.465 N SLCO6A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13176 pDONR223 100% 70.1% 70% None 393C>T;713_714ins573;1384_1398del n/a
2 ccsbBroad304_13176 pLX_304 0% 70.1% 70% V5 393C>T;713_714ins573;1384_1398del n/a
3 TRCN0000468261 CTCTATCCTCTATGTGATTGTCGT pLX_317 4.2% 70.1% 70% V5 393C>T;713_714ins573;1384_1398del n/a
Download CSV