Transcript: Human NM_001308159.2

Homo sapiens transforming growth factor alpha (TGFA), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TGFA (7039)
Length:
4278
CDS:
206..703

Additional Resources:

NCBI RefSeq record:
NM_001308159.2
NBCI Gene record:
TGFA (7039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364609 TGCAGCAGTGGTGTCCCATTT pLKO_005 331 CDS 100% 10.800 8.640 N TGFA n/a
2 TRCN0000364536 TCATCACATGTGTGCTGATAC pLKO_005 564 CDS 100% 10.800 7.560 N TGFA n/a
3 TRCN0000006373 CCACGATTTCAAGACTTGTTA pLKO.1 918 3UTR 100% 5.625 3.938 N TGFA n/a
4 TRCN0000006374 TGGCTGTCCTTATCATCACAT pLKO.1 552 CDS 100% 4.950 3.465 N TGFA n/a
5 TRCN0000376412 TCTGCCATTCTGGGTACGTTG pLKO_005 435 CDS 100% 4.050 2.835 N TGFA n/a
6 TRCN0000006377 CCTTATCATCACATGTGTGCT pLKO.1 559 CDS 100% 2.640 1.848 N TGFA n/a
7 TRCN0000006376 CTTCCATGGAACCTGCAGGTT pLKO.1 385 CDS 100% 2.640 1.848 N TGFA n/a
8 TRCN0000369238 TGAAGGGAAGAACCGCTTGCT pLKO_005 660 CDS 100% 2.640 1.848 N TGFA n/a
9 TRCN0000369237 CCAGAAGAAGCAGGCCATCAC pLKO_005 502 CDS 100% 1.350 0.945 N TGFA n/a
10 TRCN0000369163 CCAGATTCCCACACTCAGTTC pLKO_005 362 CDS 100% 4.050 2.430 N TGFA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01664 pDONR223 100% 93.7% 90.9% None (many diffs) n/a
2 ccsbBroad304_01664 pLX_304 0% 93.7% 90.9% V5 (many diffs) n/a
3 TRCN0000471784 ACACGTAACCAGGCTGCGGTGGCG pLX_317 100% 93.7% 90.9% V5 (many diffs) n/a
Download CSV