Transcript: Human NM_001308268.1

Homo sapiens protein tyrosine phosphatase receptor type N2 (PTPRN2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Homo sapiens (human)
Gene:
PTPRN2 (5799)
Length:
4965
CDS:
171..3287

Additional Resources:

NCBI RefSeq record:
NM_001308268.1
NBCI Gene record:
PTPRN2 (5799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235409 GGACGACGATGATAGACTTTA pLKO_005 1385 CDS 100% 13.200 18.480 N PTPRN2 n/a
2 TRCN0000235408 TCACGTGGCAGGATGACTATA pLKO_005 520 CDS 100% 13.200 18.480 N PTPRN2 n/a
3 TRCN0000217975 ACGTAGAGATGATTCGGATTT pLKO_005 4427 3UTR 100% 10.800 15.120 N PTPRN2 n/a
4 TRCN0000235407 CGTCAAGAGCCAGACGTATTC pLKO_005 1577 CDS 100% 10.800 15.120 N PTPRN2 n/a
5 TRCN0000003251 CAAGAGCCAGACGTATTCCAA pLKO.1 1580 CDS 100% 3.000 4.200 N PTPRN2 n/a
6 TRCN0000003249 CGACGATGATAGACTTTACCA pLKO.1 1388 CDS 100% 3.000 4.200 N PTPRN2 n/a
7 TRCN0000003250 GCACGTAGAGATGATTCGGAT pLKO.1 4425 3UTR 100% 2.640 2.112 N PTPRN2 n/a
8 TRCN0000003247 AGGTGCTAAAGAGATTGATAT pLKO.1 3140 CDS 100% 13.200 9.240 N PTPRN2 n/a
9 TRCN0000003248 TCCAATCTCTACCACATCTAT pLKO.1 2832 CDS 100% 5.625 3.938 N PTPRN2 n/a
10 TRCN0000218373 CAGTTGACAACAAAGACAAAC pLKO_005 1960 CDS 100% 10.800 6.480 N PTPRN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488930 CTCCCAAGGCGTAGTCAGACACGA pLX_317 11% 95.5% 94.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV