Transcript: Human NM_001308316.1

Homo sapiens tetraspanin 2 (TSPAN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TSPAN2 (10100)
Length:
3143
CDS:
69..650

Additional Resources:

NCBI RefSeq record:
NM_001308316.1
NBCI Gene record:
TSPAN2 (10100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244843 CAATGTGTGCTTGGATCATTT pLKO_005 321 CDS 100% 13.200 18.480 N TSPAN2 n/a
2 TRCN0000244847 CCACTAAGCAACAATAGATTT pLKO_005 2750 3UTR 100% 13.200 18.480 N TSPAN2 n/a
3 TRCN0000244844 ATCACCTTCCACTCAACATTT pLKO_005 495 CDS 100% 13.200 9.240 N TSPAN2 n/a
4 TRCN0000150915 GAAACTCACGAGATGTGATAT pLKO.1 628 CDS 100% 13.200 9.240 N TSPAN2 n/a
5 TRCN0000152521 GAGGTGCCATAAAGGAGTTAT pLKO.1 184 CDS 100% 13.200 9.240 N TSPAN2 n/a
6 TRCN0000152791 GACCATGTATGAAGAGGCTTA pLKO.1 431 CDS 100% 4.050 2.835 N TSPAN2 n/a
7 TRCN0000157069 GCTGAAGTAACCACTGGAGTA pLKO.1 369 CDS 100% 4.050 2.835 N TSPAN2 n/a
8 TRCN0000153441 CCTTCCACTCAACATTTCAGT pLKO.1 499 CDS 100% 3.000 2.100 N TSPAN2 n/a
9 TRCN0000151095 GAGGCTTACAATGATTACCTT pLKO.1 444 CDS 100% 3.000 2.100 N TSPAN2 n/a
10 TRCN0000158094 CAATGGGACACTCATCACCTT pLKO.1 482 CDS 100% 2.640 1.848 N TSPAN2 n/a
11 TRCN0000152007 CTTTGGCATGATATTCAGCAT pLKO.1 587 CDS 100% 2.640 1.848 N TSPAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07550 pDONR223 100% 87.1% 87.3% None 228G>A;515_516ins84 n/a
2 ccsbBroad304_07550 pLX_304 0% 87.1% 87.3% V5 228G>A;515_516ins84 n/a
3 TRCN0000470782 ACATAGAGCGTCCCGCTCTGTTAA pLX_317 69.1% 87.1% 87.3% V5 228G>A;515_516ins84 n/a
Download CSV