Transcript: Human NM_001308326.1

Homo sapiens coiled-coil domain containing 58 (CCDC58), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CCDC58 (131076)
Length:
756
CDS:
76..468

Additional Resources:

NCBI RefSeq record:
NM_001308326.1
NBCI Gene record:
CCDC58 (131076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129484 GCGGGCTTTCTAGGATGATTT pLKO.1 555 3UTR 100% 13.200 18.480 N CCDC58 n/a
2 TRCN0000434268 GGTCATCTCATAAGAGCTAAG pLKO_005 515 3UTR 100% 6.000 8.400 N CCDC58 n/a
3 TRCN0000423569 TTTAAGGACTGGGTCATCTCA pLKO_005 504 3UTR 100% 3.000 4.200 N CCDC58 n/a
4 TRCN0000412369 ATGAATTAAACACTACGGTTC pLKO_005 128 CDS 100% 2.250 1.800 N CCDC58 n/a
5 TRCN0000128089 CCAGTAGAGACAGAGTCATAA pLKO.1 227 CDS 100% 13.200 9.240 N CCDC58 n/a
6 TRCN0000128069 GCAGTCAGAACTGAATGTTGA pLKO.1 369 CDS 100% 4.950 3.465 N CCDC58 n/a
7 TRCN0000129358 GAGTCTTTGATGGCAGCTCAT pLKO.1 205 CDS 100% 4.050 2.835 N CCDC58 n/a
8 TRCN0000419607 GATGAGGACAATTGATGACAG pLKO_005 99 CDS 100% 4.050 2.835 N CCDC58 n/a
9 TRCN0000129683 CATCTCATAAGAGCTAAGCAT pLKO.1 518 3UTR 100% 3.000 2.100 N CCDC58 n/a
10 TRCN0000128290 GCAGACAAAGTTGAAATGGAT pLKO.1 348 CDS 100% 3.000 2.100 N CCDC58 n/a
11 TRCN0000128644 CAAAGTTGAAATGGATGCAGT pLKO.1 353 CDS 100% 2.640 1.848 N CCDC58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04870 pDONR223 100% 89.3% 88.8% None 0_1ins43;2delT;5_6delGGinsTC n/a
2 ccsbBroad304_04870 pLX_304 0% 89.3% 88.8% V5 0_1ins43;2delT;5_6delGGinsTC n/a
3 TRCN0000491783 CAACCGTCTACAATTCTAAAACAT pLX_317 58% 89.3% 88.8% V5 0_1ins43;2delT;5_6delGGinsTC n/a
Download CSV