Transcript: Human NM_001308342.2

Homo sapiens calponin 1 (CNN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CNN1 (1264)
Length:
1765
CDS:
494..1237

Additional Resources:

NCBI RefSeq record:
NM_001308342.2
NBCI Gene record:
CNN1 (1264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426285 GAGAAGGGCGGAACATCATTG pLKO_005 816 CDS 100% 10.800 15.120 N CNN1 n/a
2 TRCN0000432726 GTGCTACAGGGTCCAACATAG pLKO_005 1435 3UTR 100% 10.800 15.120 N CNN1 n/a
3 TRCN0000421921 AGATCAATGAGTCAACCCAAA pLKO_005 564 CDS 100% 4.050 5.670 N CNN1 n/a
4 TRCN0000179672 GAAGATCAATGAGTCAACCCA pLKO.1 562 CDS 100% 0.750 1.050 N CNN1 n/a
5 TRCN0000417692 ACTTCATGGACGGCCTCAAAG pLKO_005 489 5UTR 100% 10.800 7.560 N CNN1 n/a
6 TRCN0000430721 GACGCACTGAGCAACGCTATT pLKO_005 1484 3UTR 100% 10.800 7.560 N CNN1 n/a
7 TRCN0000155868 CATGGCGAAGACGAAAGGAAA pLKO.1 730 CDS 100% 4.950 3.465 N CNN1 n/a
8 TRCN0000417997 GGGAGTGAAGTACGCAGAGAA pLKO_005 763 CDS 100% 4.950 3.465 N CNN1 n/a
9 TRCN0000413481 TTGAGAACACCAACCATACAC pLKO_005 678 CDS 100% 4.950 3.465 N CNN1 n/a
10 TRCN0000179389 GACGAAAGGAAACAAGGTGAA pLKO.1 739 CDS 100% 4.050 2.835 N CNN1 n/a
11 TRCN0000154401 GAACTCAACCTCTACAGGGTT pLKO.1 1351 3UTR 100% 2.640 1.848 N CNN1 n/a
12 TRCN0000178949 CAACTACTACAATTCCGCCTA pLKO.1 1216 CDS 100% 2.160 1.512 N CNN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00338 pDONR223 100% 83.1% 83.1% None 0_1ins150 n/a
2 ccsbBroad304_00338 pLX_304 0% 83.1% 83.1% V5 0_1ins150 n/a
3 TRCN0000473994 TTGCCTACAGGTCACGACGCCCAG pLX_317 58.3% 83.1% 83.1% V5 0_1ins150 n/a
Download CSV