Transcript: Mouse NM_001308506.1

Mus musculus nicotinamide nucleotide transhydrogenase (Nnt), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nnt (18115)
Length:
3666
CDS:
408..2915

Additional Resources:

NCBI RefSeq record:
NM_001308506.1
NBCI Gene record:
Nnt (18115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041886 GCTTCAATGTTGTCGTGGAAT pLKO.1 664 CDS 100% 4.950 3.960 N Nnt n/a
2 TRCN0000309525 GCTTCAATGTTGTCGTGGAAT pLKO_005 664 CDS 100% 4.950 3.960 N Nnt n/a
3 TRCN0000041887 CCCTATGATATTGTGTTAGAA pLKO.1 2601 CDS 100% 5.625 3.938 N Nnt n/a
4 TRCN0000309526 CCCTATGATATTGTGTTAGAA pLKO_005 2601 CDS 100% 5.625 3.938 N Nnt n/a
5 TRCN0000041884 GCCGAGTACATCGTAGAGTAT pLKO.1 1812 CDS 100% 4.950 3.465 N Nnt n/a
6 TRCN0000309450 GCCGAGTACATCGTAGAGTAT pLKO_005 1812 CDS 100% 4.950 3.465 N Nnt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15765 pDONR223 0% 22% 24.3% None (many diffs) n/a
2 ccsbBroad304_15765 pLX_304 0% 22% 24.3% V5 (many diffs) n/a
Download CSV