Transcript: Mouse NM_001309814.1

Mus musculus synaptojanin 2 binding protein (Synj2bp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Synj2bp (24071)
Length:
852
CDS:
133..489

Additional Resources:

NCBI RefSeq record:
NM_001309814.1
NBCI Gene record:
Synj2bp (24071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001309814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105831 GATAAGATCCTCTCGGTAAAT pLKO.1 319 CDS 100% 13.200 6.600 Y Synj2bp n/a
2 TRCN0000316682 GATAAGATCCTCTCGGTAAAT pLKO_005 319 CDS 100% 13.200 6.600 Y Synj2bp n/a
3 TRCN0000105832 CATCTACGTCAGCCGTATCAA pLKO.1 255 CDS 100% 5.625 2.813 Y Synj2bp n/a
4 TRCN0000316748 CATCTACGTCAGCCGTATCAA pLKO_005 255 CDS 100% 5.625 2.813 Y Synj2bp n/a
5 TRCN0000139049 CAGGAGGGTGATAAGATCCTT pLKO.1 310 CDS 100% 3.000 1.500 Y SYNJ2BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001309814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08522 pDONR223 100% 71.2% 60% None (many diffs) n/a
2 ccsbBroad304_08522 pLX_304 0% 71.2% 60% V5 (many diffs) n/a
3 TRCN0000478302 CATATGCGTTCGCTCCAACCTGTC pLX_317 70.3% 71.2% 60% V5 (many diffs) n/a
Download CSV