Transcript: Mouse NM_001310088.1

Mus musculus activity-dependent neuroprotective protein (Adnp), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Adnp (11538)
Length:
4840
CDS:
1116..3758

Additional Resources:

NCBI RefSeq record:
NM_001310088.1
NBCI Gene record:
Adnp (11538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304335 CAAGCTGCAGTGCCCTATAAA pLKO_005 2256 CDS 100% 15.000 7.500 Y Adnp n/a
2 TRCN0000304334 CTGTAGTCTCAGTGGTTATTT pLKO_005 3905 3UTR 100% 15.000 7.500 Y Adnp n/a
3 TRCN0000304375 CAATACCAAAGCCCAACTTAA pLKO_005 1354 CDS 100% 13.200 6.600 Y Adnp n/a
4 TRCN0000081671 GATTCTTATGAGGCTAGGAAA pLKO.1 2712 CDS 100% 4.950 2.475 Y Adnp n/a
5 TRCN0000301627 GATTCTTATGAGGCTAGGAAA pLKO_005 2712 CDS 100% 4.950 2.475 Y Adnp n/a
6 TRCN0000081668 GCCTACAGATACCCTACTCAA pLKO.1 1922 CDS 100% 4.950 2.475 Y Adnp n/a
7 TRCN0000301626 GCCTACAGATACCCTACTCAA pLKO_005 1922 CDS 100% 4.950 2.475 Y Adnp n/a
8 TRCN0000081672 GATAATTTAGAGGAGCCTGTA pLKO.1 3144 CDS 100% 4.050 2.025 Y Adnp n/a
9 TRCN0000081670 CCGTGAAACAGTTACTTCCAA pLKO.1 1525 CDS 100% 3.000 1.500 Y Adnp n/a
10 TRCN0000081669 CCATTTCAGTAACAAGAGGAA pLKO.1 2834 CDS 100% 2.640 1.320 Y Adnp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310088.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.