Transcript: Human NM_001310320.2

Homo sapiens milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
MFGE8 (4240)
Length:
1989
CDS:
138..1277

Additional Resources:

NCBI RefSeq record:
NM_001310320.2
NBCI Gene record:
MFGE8 (4240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001310320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029277 CGGTGGTTTATGCGAGGAGAT pLKO.1 215 CDS 100% 4.050 5.670 N MFGE8 n/a
2 TRCN0000353601 CGGTGGTTTATGCGAGGAGAT pLKO_005 215 CDS 100% 4.050 5.670 N MFGE8 n/a
3 TRCN0000029278 CTACAGTAATGACAGTGCGAA pLKO.1 1079 CDS 100% 2.640 3.696 N MFGE8 n/a
4 TRCN0000029275 ACAGCCTTAATGGACACGAAT pLKO.1 598 CDS 100% 4.950 3.960 N MFGE8 n/a
5 TRCN0000029276 TCCCACAAGAAGAACTTGTTT pLKO.1 1167 CDS 100% 0.563 0.450 N MFGE8 n/a
6 TRCN0000330314 CGATTTCATCCATGATGTTAA pLKO_005 620 CDS 100% 13.200 9.240 N MFGE8 n/a
7 TRCN0000369549 ACCCAGCAGCAATGACGATAA pLKO_005 467 CDS 100% 10.800 7.560 N MFGE8 n/a
8 TRCN0000330313 GAGGCTCAGTACGTGAGATTG pLKO_005 714 CDS 100% 10.800 7.560 N MFGE8 n/a
9 TRCN0000029274 GCAACCACTGTGAGACGAAAT pLKO.1 301 CDS 100% 10.800 7.560 N MFGE8 n/a
10 TRCN0000377293 TGGACAGGAAAGGGCAAAGTA pLKO_005 1543 3UTR 100% 5.625 3.938 N MFGE8 n/a
11 TRCN0000369614 CCTCTCTCACACATCACATTC pLKO_005 1634 3UTR 100% 10.800 6.480 N MFGE8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06579 pDONR223 100% 80.2% 78.3% None (many diffs) n/a
2 ccsbBroad304_06579 pLX_304 0% 80.2% 78.3% V5 (many diffs) n/a
3 TRCN0000466390 AAGGCTTGCCAACCGTAACATTCA pLX_317 36.1% 80.2% 78.3% V5 (many diffs) n/a
Download CSV