Transcript: Mouse NM_001310437.1

Mus musculus ankyrin 1, erythroid (Ank1), transcript variant 11, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ank1 (11733)
Length:
2974
CDS:
248..715

Additional Resources:

NCBI RefSeq record:
NM_001310437.1
NBCI Gene record:
Ank1 (11733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091928 CGTTGCTAGTAGGAGCTGTTT pLKO.1 2693 3UTR 100% 4.950 6.930 N Ank1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05816 pDONR223 100% 89.4% 91.6% None (many diffs) n/a
2 ccsbBroad304_05816 pLX_304 0% 89.4% 91.6% V5 (many diffs) n/a
3 TRCN0000474255 CCGCTCAGACTCACTGCTCAAATT pLX_317 78.1% 89.4% 91.6% V5 (many diffs) n/a
4 ccsbBroadEn_10678 pDONR223 100% 71.9% 72.9% None (many diffs) n/a
5 ccsbBroad304_10678 pLX_304 0% 71.9% 72.9% V5 (many diffs) n/a
6 TRCN0000472544 GTTGCCTAACTCTATTAAATGTCT pLX_317 100% 71.9% 72.9% V5 (many diffs) n/a
Download CSV