Transcript: Mouse NM_001310536.1

Mus musculus Rap guanine nucleotide exchange factor (GEF) 2 (Rapgef2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Rapgef2 (76089)
Length:
6510
CDS:
189..4463

Additional Resources:

NCBI RefSeq record:
NM_001310536.1
NBCI Gene record:
Rapgef2 (76089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239101 AGCAAGATTACTGCCGTATTT pLKO_005 655 CDS 100% 13.200 18.480 N Rapgef2 n/a
2 TRCN0000239100 TAAGGTGACGCGGGTAGTATT pLKO_005 953 CDS 100% 13.200 18.480 N Rapgef2 n/a
3 TRCN0000036987 CCATACAATGATATTGGGATT pLKO.1 1617 CDS 100% 4.050 5.670 N RAPGEF2 n/a
4 TRCN0000336955 CAACTGAGTGGAAGGTATTAT pLKO_005 2010 CDS 100% 15.000 10.500 N RAPGEF2 n/a
5 TRCN0000239103 CCTGATGGAGCCTGATCAATA pLKO_005 3548 CDS 100% 13.200 9.240 N Rapgef2 n/a
6 TRCN0000239102 GATCAGTAGATAAACGTAAAT pLKO_005 5924 3UTR 100% 13.200 9.240 N Rapgef2 n/a
7 TRCN0000036984 CCAGCAAGATTACTGCCGTAT pLKO.1 653 CDS 100% 4.050 2.835 N RAPGEF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.