Transcript: Mouse NM_001310604.1

Mus musculus leucine-rich repeat LGI family, member 2 (Lgi2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lgi2 (246316)
Length:
6291
CDS:
202..1830

Additional Resources:

NCBI RefSeq record:
NM_001310604.1
NBCI Gene record:
Lgi2 (246316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216439 GAAATGAATTTCCGGAGTTAT pLKO.1 979 CDS 100% 13.200 18.480 N Lgi2 n/a
2 TRCN0000198027 CGTTGGAACAGTAAGCAGTTT pLKO.1 1531 CDS 100% 4.950 6.930 N Lgi2 n/a
3 TRCN0000178083 GCTTTGACTATGAGTGTACCA pLKO.1 821 CDS 100% 2.640 3.696 N Lgi2 n/a
4 TRCN0000182375 GCGTTGGAACAGTAAGCAGTT pLKO.1 1530 CDS 100% 4.050 3.240 N Lgi2 n/a
5 TRCN0000198185 CCAGCTTTGACTATGAGTGTA pLKO.1 818 CDS 100% 4.950 3.465 N Lgi2 n/a
6 TRCN0000182601 GAGCTGGACCAAGTTTGTCAA pLKO.1 1113 CDS 100% 4.950 3.465 N Lgi2 n/a
7 TRCN0000200070 CCCTGAGCCTAGTAAATGGAA pLKO.1 386 CDS 100% 3.000 2.100 N Lgi2 n/a
8 TRCN0000182131 CCAGTCACTACATGAGTGGTT pLKO.1 1284 CDS 100% 2.640 1.848 N Lgi2 n/a
9 TRCN0000177840 CCTGTTCATTGAAGGGAACAA pLKO.1 531 CDS 100% 0.495 0.347 N Lgi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08490 pDONR223 100% 90% 97.6% None (many diffs) n/a
2 ccsbBroad304_08490 pLX_304 0% 90% 97.6% V5 (many diffs) n/a
3 TRCN0000481617 CACACCCCACCATCCCGGGATTTC pLX_317 27.3% 90% 97.6% V5 (many diffs) n/a
Download CSV