Transcript: Mouse NM_001310639.1

Mus musculus signal transducing adaptor family member 1 (Stap1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stap1 (56792)
Length:
1111
CDS:
93..872

Additional Resources:

NCBI RefSeq record:
NM_001310639.1
NBCI Gene record:
Stap1 (56792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105850 CATGACACCTTTCTTCATTTA pLKO.1 878 3UTR 100% 13.200 9.240 N Stap1 n/a
2 TRCN0000105851 CGAGGGAATTTGAGACCATTT pLKO.1 765 CDS 100% 10.800 7.560 N Stap1 n/a
3 TRCN0000105853 CACCAGGAGTACAAACACTAT pLKO.1 207 CDS 100% 4.950 3.465 N Stap1 n/a
4 TRCN0000065087 CCTGTAACACTCCCAAACCTT pLKO.1 711 CDS 100% 3.000 2.100 N STAP1 n/a
5 TRCN0000105854 GCTGATGACAACTTTGGTCAA pLKO.1 795 CDS 100% 4.050 2.430 N Stap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02933 pDONR223 100% 73.8% 72.7% None (many diffs) n/a
2 ccsbBroad304_02933 pLX_304 0% 73.8% 72.7% V5 (many diffs) n/a
3 TRCN0000491944 CCAGCCGGTCTCAAAACAGGCGGT pLX_317 36.7% 73.8% 72.7% V5 (many diffs) n/a
Download CSV