Transcript: Mouse NM_001310753.1

Mus musculus dual adaptor for phosphotyrosine and 3-phosphoinositides 1 (Dapp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Mus musculus (mouse)
Gene:
Dapp1 (26377)
Length:
2973
CDS:
131..850

Additional Resources:

NCBI RefSeq record:
NM_001310753.1
NBCI Gene record:
Dapp1 (26377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105746 CGTCCGATCTAGGTCATTTAT pLKO.1 820 CDS 100% 15.000 21.000 N Dapp1 n/a
2 TRCN0000105747 CGGGAGTTGAAGCCGATGAAT pLKO.1 735 CDS 100% 5.625 7.875 N Dapp1 n/a
3 TRCN0000105748 TCGGCTTTAATGAGTATTCAT pLKO.1 288 CDS 100% 5.625 7.875 N Dapp1 n/a
4 TRCN0000105749 GTACTCGTTTAAATTCGGCTT pLKO.1 274 CDS 100% 2.160 3.024 N Dapp1 n/a
5 TRCN0000105745 CGTCTAATGATAAACTGAGAA pLKO.1 1689 3UTR 100% 4.950 3.960 N Dapp1 n/a
6 TRCN0000440521 GGCTTTAGGAAGCAGATTAAT pLKO_005 1246 3UTR 100% 15.000 10.500 N Dapp1 n/a
7 TRCN0000449544 AGGCTCATTGACTTTAGTTTC pLKO_005 1131 3UTR 100% 10.800 7.560 N Dapp1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1450 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491823 CAATCCAGATACCGGCCCTCTAGG pLX_317 36% 74.8% 79.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV