Construct: ORF TRCN0000491823
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021572.2_s317c1
- DNA Barcode:
- CAATCCAGATACCGGCCCTCTAGG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- DAPP1 (27071)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491823
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | NM_014395.3 | 100% | 100% | |
| 2 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XM_011531840.2 | 94% | 93.5% | (many diffs) |
| 3 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | NM_001306151.2 | 93.3% | 92.1% | (many diffs) |
| 4 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XM_011531842.1 | 83.2% | 79.7% | 686_726del;774_775ins107 |
| 5 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XM_017008023.1 | 83.2% | 79.7% | 686_726del;774_775ins107 |
| 6 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XM_017008024.1 | 83.2% | 79.7% | 686_726del;774_775ins107 |
| 7 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XM_011531843.3 | 56.4% | 56.4% | 0_1ins366 |
| 8 | human | 27071 | DAPP1 | dual adaptor of phosphotyro... | XR_001741200.1 | 27.1% | (many diffs) | |
| 9 | mouse | 26377 | Dapp1 | dual adaptor for phosphotyr... | NM_011932.3 | 87.7% | 93.2% | (many diffs) |
| 10 | mouse | 26377 | Dapp1 | dual adaptor for phosphotyr... | NM_001310753.1 | 74.8% | 79.2% | (many diffs) |
| 11 | mouse | 26377 | Dapp1 | dual adaptor for phosphotyr... | XM_017319585.2 | 49% | 53.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 912
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggcaga gcagaacttc tagaagggaa gatgagcacc caggatccct 121 cagatctgtg gagcagatcc gatggagagg ctgagctgct ccaggacttg gggtggtatc 181 acggcaacct cacacgccat gctgctgaag ctcttctcct ctcaaatgga tgtgacggca 241 gctaccttct gagggacagc aatgagacca ccgggctgta ctctctctct gtgagggcca 301 aagattctgt taaacacttt catgttgaat atactggata ttcatttaaa tttggcttta 361 atgaattctc atctttgaag gattttgtca agcattttgc aaatcagcct ttgattggaa 421 gcgagacagg cactctgatg gttctaaaac atccctaccc aagaaaagtg gaagaaccct 481 ccatttatga atctgtccgg gttcacacag caatgcagac aggaagaaca gaagatgacc 541 ttgtgcccac agcaccttct ctgggcacca aagaaggtta cctcaccaaa cagggaggcc 601 tggtcaagac ctGGAAAACA AGATGGTTTA CTCTGCACAG GAATGAACTG AAATACTTCA 661 AAGACCAGAT GTCACCAGAA CCAATTCGGA TCCTAGACCT AACAGAATGT TCAGCTGTAC 721 AATTCGATTA TTCACAAGAA AGGGTAAACT GTTTTTGTTT GGTATTTCCA TTCAGGACAT 781 TTTATCTCTG TGCAAAGACC GGAGTAGAAG CTGATGAGTG GATCAAGATA TTACGCTGGA 841 AATTGTCACA AATAAGAAAA CAGCTCAACC AAGGGGAAGG CACGATCCGA TCTCGGTCGT 901 TCATCTTTAA ATAGAACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 961 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1021 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CAATCCAGAT ACCGGCCCTC 1081 TAGGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt