Transcript: Mouse NM_001311062.1

Mus musculus nicotinamide N-methyltransferase (Nnmt), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nnmt (18113)
Length:
882
CDS:
166..639

Additional Resources:

NCBI RefSeq record:
NM_001311062.1
NBCI Gene record:
Nnmt (18113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314089 AGAGTAGCTACTACATGATTG pLKO_005 633 CDS 100% 10.800 15.120 N Nnmt n/a
2 TRCN0000314088 ATTCTGCCTGGGTGCTGTAAA pLKO_005 309 CDS 100% 13.200 9.240 N Nnmt n/a
3 TRCN0000097465 GTCACCTATGTGTGTGATCTT pLKO.1 496 CDS 100% 4.950 3.465 N Nnmt n/a
4 TRCN0000097467 TGAGTCCTTCACGGAGATCAT pLKO.1 390 CDS 100% 4.950 3.465 N Nnmt n/a
5 TRCN0000317884 TGAGTCCTTCACGGAGATCAT pLKO_005 390 CDS 100% 4.950 3.465 N Nnmt n/a
6 TRCN0000314039 GGCTTCCTGGTGATGGTAGAT pLKO_005 605 CDS 100% 4.950 2.970 N Nnmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06646 pDONR223 100% 50.7% 47.3% None (many diffs) n/a
2 ccsbBroad304_06646 pLX_304 0% 50.7% 47.3% V5 (many diffs) n/a
3 TRCN0000468383 CCCCTCCCAATTCCCCGTTAGACG pLX_317 55.5% 50.7% 47.3% V5 (many diffs) n/a
Download CSV