Transcript: Mouse NM_001311097.1

Mus musculus sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A (Sema6a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Sema6a (20358)
Length:
6738
CDS:
672..3602

Additional Resources:

NCBI RefSeq record:
NM_001311097.1
NBCI Gene record:
Sema6a (20358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112319 CCAATGAGTTTCCCGATGATA pLKO.1 1813 CDS 100% 5.625 7.875 N Sema6a n/a
2 TRCN0000112316 GCTCGAATATAAGAGGAGCTA pLKO.1 3248 CDS 100% 2.640 3.696 N Sema6a n/a
3 TRCN0000431585 GTATTTCGCATGGCAACTATA pLKO_005 754 CDS 100% 13.200 9.240 N SEMA6A n/a
4 TRCN0000061109 CCTGAGAACAATGGTCAGATA pLKO.1 1904 CDS 100% 4.950 3.465 N SEMA6A n/a
5 TRCN0000112318 CCTGGAGTATAAGACCATCAA pLKO.1 3056 CDS 100% 4.950 3.465 N Sema6a n/a
6 TRCN0000112317 GCCTATGACATGCTTGACATT pLKO.1 1656 CDS 100% 4.950 3.465 N Sema6a n/a
7 TRCN0000112315 CCCATGTTAATGGGCATCATT pLKO.1 6279 3UTR 100% 0.563 0.394 N Sema6a n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3956 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.