Transcript: Mouse NM_001311121.1

Mus musculus elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 (Elovl2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Elovl2 (54326)
Length:
3914
CDS:
175..1002

Additional Resources:

NCBI RefSeq record:
NM_001311121.1
NBCI Gene record:
Elovl2 (54326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009781 CGTTTCTTCATGGCAAGTCTT pLKO.1 1297 3UTR 100% 4.950 6.930 N Elovl2 n/a
2 TRCN0000009784 CACACTTCTTTCTGCGTATAT pLKO.1 348 CDS 100% 13.200 9.240 N Elovl2 n/a
3 TRCN0000009782 GCCCACTTAATTGTGGCTAAT pLKO.1 955 CDS 100% 10.800 7.560 N Elovl2 n/a
4 TRCN0000413262 TGGAGTTCCTGGACACGATTT pLKO_005 497 CDS 100% 10.800 7.560 N Elovl2 n/a
5 TRCN0000009785 GCTTTCTTGGACAACATGTTT pLKO.1 160 5UTR 100% 5.625 3.938 N Elovl2 n/a
6 TRCN0000009783 GCTGGGTAACAAGTACATGAA pLKO.1 273 CDS 100% 4.950 3.465 N Elovl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08428 pDONR223 100% 79.3% 83.4% None (many diffs) n/a
2 ccsbBroad304_08428 pLX_304 0% 79.3% 83.4% V5 (many diffs) n/a
3 TRCN0000468130 CCCGTAAACACTCCTTGTCTCGAT pLX_317 52.8% 79.3% 83.4% V5 (many diffs) n/a
Download CSV