Transcript: Mouse NM_001311134.1

Mus musculus chimerin 2 (Chn2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Chn2 (69993)
Length:
2707
CDS:
289..1122

Additional Resources:

NCBI RefSeq record:
NM_001311134.1
NBCI Gene record:
Chn2 (69993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313835 ATATGACACCTACTCCAAATT pLKO_005 810 CDS 100% 13.200 9.240 N Chn2 n/a
2 TRCN0000112401 CCAACATCTACCCAGACATAA pLKO.1 731 CDS 100% 13.200 9.240 N Chn2 n/a
3 TRCN0000317418 CCAACATCTACCCAGACATAA pLKO_005 731 CDS 100% 13.200 9.240 N Chn2 n/a
4 TRCN0000112402 GTGTTCAGATTGTGGGTTAAA pLKO.1 447 CDS 100% 13.200 9.240 N Chn2 n/a
5 TRCN0000317417 GTGTTCAGATTGTGGGTTAAA pLKO_005 447 CDS 100% 13.200 9.240 N Chn2 n/a
6 TRCN0000112404 CGTACACAAACAGTGCTCCAA pLKO.1 468 CDS 100% 2.640 1.848 N Chn2 n/a
7 TRCN0000112403 TGGACATATGTATTCGGGAAA pLKO.1 596 CDS 100% 0.000 0.000 N Chn2 n/a
8 TRCN0000317353 TGGACATATGTATTCGGGAAA pLKO_005 596 CDS 100% 0.000 0.000 N Chn2 n/a
9 TRCN0000112400 GCCTCGTATGTATGTCTGTTT pLKO.1 1310 3UTR 100% 4.950 2.970 N Chn2 n/a
10 TRCN0000317355 GCCTCGTATGTATGTCTGTTT pLKO_005 1310 3UTR 100% 4.950 2.970 N Chn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477804 GCCGCGAGTCAAACACCACACCAG pLX_317 34% 54.1% 58.1% V5 (many diffs) n/a
2 ccsbBroadEn_05996 pDONR223 100% 54% 58.1% None (many diffs) n/a
3 ccsbBroad304_05996 pLX_304 0% 54% 58.1% V5 (many diffs) n/a
Download CSV