Construct: ORF TRCN0000477804
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006271.1_s317c1
- Derived from:
- ccsbBroadEn_05996
- DNA Barcode:
- GCCGCGAGTCAAACACCACACCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHN2 (1124)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477804
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1124 | CHN2 | chimerin 2 | NM_004067.3 | 100% | 100% | |
| 2 | human | 1124 | CHN2 | chimerin 2 | NM_001293070.1 | 97.2% | 97% | 50_88del |
| 3 | human | 1124 | CHN2 | chimerin 2 | NM_001293072.1 | 96.7% | 96.5% | 1_1delAins40;3_4insTCCTCC |
| 4 | human | 1124 | CHN2 | chimerin 2 | XM_011515107.2 | 94.7% | 94.7% | 49_126del |
| 5 | human | 1124 | CHN2 | chimerin 2 | XM_017011722.1 | 93.6% | 93.6% | 49_144del |
| 6 | human | 1124 | CHN2 | chimerin 2 | NM_001293071.1 | 92.5% | 89.7% | 0_1ins49;39_40ins56 |
| 7 | human | 1124 | CHN2 | chimerin 2 | NM_001293069.1 | 83.6% | 83.9% | (many diffs) |
| 8 | human | 1124 | CHN2 | chimerin 2 | XM_011515106.2 | 82.2% | 81.7% | (many diffs) |
| 9 | human | 1124 | CHN2 | chimerin 2 | XM_011515105.2 | 81.1% | 79.7% | (many diffs) |
| 10 | human | 1124 | CHN2 | chimerin 2 | XM_017011721.1 | 80.5% | 78.9% | (many diffs) |
| 11 | human | 1124 | CHN2 | chimerin 2 | NM_001039936.2 | 67.4% | 58.5% | (many diffs) |
| 12 | human | 1124 | CHN2 | chimerin 2 | NM_001293073.1 | 58.5% | 54.7% | (many diffs) |
| 13 | human | 1124 | CHN2 | chimerin 2 | NM_001293080.1 | 57.6% | 48.9% | (many diffs) |
| 14 | human | 1124 | CHN2 | chimerin 2 | NM_001293076.1 | 55% | 46.7% | (many diffs) |
| 15 | human | 1124 | CHN2 | chimerin 2 | NM_001293081.1 | 54.4% | 53.2% | (many diffs) |
| 16 | human | 1124 | CHN2 | chimerin 2 | NM_001293077.1 | 52.1% | 43.6% | (many diffs) |
| 17 | human | 1124 | CHN2 | chimerin 2 | NM_001293075.1 | 48.8% | 44.6% | (many diffs) |
| 18 | human | 1124 | CHN2 | chimerin 2 | NM_001293078.1 | 45.3% | 37.1% | (many diffs) |
| 19 | human | 1124 | CHN2 | chimerin 2 | NM_001293079.1 | 38.5% | 30.4% | (many diffs) |
| 20 | mouse | 69993 | Chn2 | chimerin 2 | NM_001163640.1 | 90.4% | 97.6% | (many diffs) |
| 21 | mouse | 69993 | Chn2 | chimerin 2 | NM_023543.2 | 62.5% | 57.5% | (many diffs) |
| 22 | mouse | 69993 | Chn2 | chimerin 2 | NM_001311133.1 | 54.7% | 58.2% | (many diffs) |
| 23 | mouse | 69993 | Chn2 | chimerin 2 | NM_001311134.1 | 54.1% | 58.1% | (many diffs) |
| 24 | mouse | 69993 | Chn2 | chimerin 2 | XM_006506578.3 | 54.1% | 58.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1473
- ORF length:
- 1404
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcagcgtcc agcaactcca gcctgtccgg ctcgtcggtg tcctccgatg 121 ctgaagaata ccagcctcct atatggaaat catacttata tcagttacag caagaggcac 181 ctcgtcccaa gagaatcatt tgtcctcggg aggtggaaaa cagaccaaaa tattatggaa 241 gagagtttca tgggatcatc tctcgggagc aggcggatga gcttcttgga ggcgtggagg 301 gtgcctacat ccttagagaa agccagcggc aaccaggatg ctacacgctg gctctcaggt 361 ttggaaacca gaccttaaac tacaggctct tccacgacgg gaaacacttt gtgggtgaga 421 agaggtttga gtcgattcat gatctggtga cagatggctt gataacactg tacatagaaa 481 caaaagctgc cgagtacatt tcaaaaatga caactaaccc catctatgaa cacattggat 541 atgccaccct actcagagaa aaagtatcca gaaggctgag caggtctaaa aatgaaccaa 601 gaaaaacaaa cgtcacacat gaagaacaca cagcggtgga aaagatctcc tccctggttc 661 gaagggctgc cctcacacac aacgacaacc acttcaatta tgagaagaca cacaacttta 721 aggtccacac gttccgaggc ccacactggt gtgaatattg tgccaatttc atgtgggggc 781 tcatcgccca aggggtccgg tgctcagact gtggattgaa cgtacacaaa cagtgttcca 841 agcacgttcc caatgactgc caacctgatc tcaagaggat caagaaagtg tactgttgtg 901 acctcacaac acttgtgaag gctcacaaca ctcagagacc catggtggta gacatatgca 961 ttcgggaaat tgaagcaaga ggattaaaat cggaaggCCT TTACAGAGTC TCTGGGTTCA 1021 CTGAACACAT TGAAGATGTC AAAATGGCAT TTGACAGAGA TGGTGAAAAG GCCGATATAT 1081 CTGCCAATGT CTATCCAGAC ATAAACATCA TCACTGGAGC CCTTAAACTG TATTTCAGAG 1141 ACTTACCCAT CCCTGTCATC ACATATGATA CCTATTCCAA ATTTATAGAT GCAGCAAAAA 1201 TCTCCAATGC AGATGAGAGG CTGGAAGCCG TCCATGAAGT GCTGATGCTG CTGCCTCCTG 1261 CCCACTATGA AACCCTCCGG TACCTAATGA TCCACCTCAA AAAGGTTACT ATGAATGAAA 1321 AAGACAATTT CATGAATGCA GAAAATCTGG GGATCGTGTT TGGGCCCACT CTGATGAGGC 1381 CCCCTGAGGA CAGCACCCTG ACCACCCTGC ATGATATGCG GTACCAAAAG CTGATTGTGC 1441 AGATTTTAAT AGAAAACGAA GACGTTTTAT TCTTGCCAAC TTTCTTGTAC AAAGTGGTTG 1501 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1561 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC 1621 CGCGAGTCAA ACACCACACC AGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1681 ttgtgaaaga tt