Transcript: Human NM_001311182.2

Homo sapiens kallikrein related peptidase 14 (KLK14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KLK14 (43847)
Length:
1026
CDS:
233..988

Additional Resources:

NCBI RefSeq record:
NM_001311182.2
NBCI Gene record:
KLK14 (43847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001311182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051528 GCAATGCGTGAACATCAACAT pLKO.1 718 CDS 100% 4.950 6.930 N KLK14 n/a
2 TRCN0000051530 CTCTCTGCAATGCGTGAACAT pLKO.1 712 CDS 100% 4.950 3.960 N KLK14 n/a
3 TRCN0000051531 AGGAAACGATGCGGGACAAAT pLKO.1 966 CDS 100% 13.200 9.240 N KLK14 n/a
4 TRCN0000051529 GCCAAGAGGATGAGAACAAGA pLKO.1 285 CDS 100% 4.950 3.465 N KLK14 n/a
5 TRCN0000372745 GCCAGAAGGCCTATCCTAGAA pLKO_005 756 CDS 100% 4.950 3.465 N KLK14 n/a
6 TRCN0000378886 TTTCAGGCCAGTGGGTCATCA pLKO_005 402 CDS 100% 4.950 3.465 N KLK14 n/a
7 TRCN0000051532 CCTGGCTATAGCCATGACACA pLKO.1 262 CDS 100% 2.640 1.848 N KLK14 n/a
8 TRCN0000372701 TTCCTCCTGCTGACAGCACTT pLKO_005 236 CDS 100% 4.050 2.430 N KLK14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03139 pDONR223 100% 94% 94% None 0_1ins48 n/a
2 ccsbBroad304_03139 pLX_304 0% 94% 94% V5 0_1ins48 n/a
3 TRCN0000476981 CAGATTCGAGGCCTCGGCGCCATA pLX_317 44.9% 94% 94% V5 0_1ins48 n/a
Download CSV