Transcript: Human NM_001312674.2

Homo sapiens coagulation factor X (F10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
F10 (2159)
Length:
1404
CDS:
58..1392

Additional Resources:

NCBI RefSeq record:
NM_001312674.2
NBCI Gene record:
F10 (2159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001312674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011049 CAGCGACAAGACGAATGAATT pLKO.1 276 CDS 100% 0.000 0.000 N F10 n/a
2 TRCN0000421085 GAAGAAAGGACACCTCGAAAG pLKO_005 201 CDS 100% 6.000 4.800 N F10 n/a
3 TRCN0000006789 AGGGCCAATTCCTTTCTTGAA pLKO.1 175 CDS 100% 4.950 3.465 N F10 n/a
4 TRCN0000421754 TGTCCAGCAGCTTCATCATCA pLKO_005 1100 CDS 100% 4.950 3.465 N F10 n/a
5 TRCN0000006790 CTGAGCGAGTTCTACATCCTA pLKO.1 721 CDS 100% 3.000 2.100 N F10 n/a
6 TRCN0000006788 GCCCTGCTCATCAATGAGGAA pLKO.1 673 CDS 100% 2.640 1.848 N F10 n/a
7 TRCN0000006791 CCTGCACCTGTTTAGAAGGAT pLKO.1 383 CDS 100% 3.000 1.800 N F10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06188 pDONR223 100% 90.9% 90.7% None 370_371ins132;660C>T n/a
2 ccsbBroad304_06188 pLX_304 0% 90.9% 90.7% V5 370_371ins132;660C>T n/a
3 TRCN0000473270 GCACAGGTACCACCATTGACAATA pLX_317 32% 90.9% 90.7% V5 370_371ins132;660C>T n/a
Download CSV