Transcript: Mouse NM_001313906.1

Mus musculus protein arginine N-methyltransferase 5 (Prmt5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Prmt5 (27374)
Length:
2720
CDS:
251..2107

Additional Resources:

NCBI RefSeq record:
NM_001313906.1
NBCI Gene record:
Prmt5 (27374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197644 CTCCAGTACTTGGAATACTTA pLKO.1 1034 CDS 100% 5.625 7.875 N Prmt5 n/a
2 TRCN0000182186 CCTCTTGTGAATGCGTCTCTT pLKO.1 1301 CDS 100% 4.950 6.930 N Prmt5 n/a
3 TRCN0000292754 CCTCTTGTGAATGCGTCTCTT pLKO_005 1301 CDS 100% 4.950 6.930 N Prmt5 n/a
4 TRCN0000303403 AGGGACTGGAATACGCTAATT pLKO_005 419 CDS 100% 13.200 9.240 N PRMT5 n/a
5 TRCN0000176621 CCCATCAAATACTCTCAATAT pLKO.1 1184 CDS 100% 13.200 9.240 N Prmt5 n/a
6 TRCN0000181891 GCACAGTTTGAGATGCCTTAT pLKO.1 1679 CDS 100% 10.800 7.560 N Prmt5 n/a
7 TRCN0000292756 GCACAGTTTGAGATGCCTTAT pLKO_005 1679 CDS 100% 10.800 7.560 N Prmt5 n/a
8 TRCN0000182569 GAAGCAGCTCTGAGTTCTCTT pLKO.1 2133 3UTR 100% 4.950 3.465 N Prmt5 n/a
9 TRCN0000107088 GCGTTTCAAGAGGGAGTTCAT pLKO.1 337 CDS 100% 4.950 3.465 N PRMT5 n/a
10 TRCN0000182693 GCGTTTCAAGAGGGAGTTCAT pLKO.1 337 CDS 100% 4.950 3.465 N Prmt5 n/a
11 TRCN0000292682 GCGTTTCAAGAGGGAGTTCAT pLKO_005 337 CDS 100% 4.950 3.465 N Prmt5 n/a
12 TRCN0000299170 GCGTTTCAAGAGGGAGTTCAT pLKO_005 337 CDS 100% 4.950 3.465 N PRMT5 n/a
13 TRCN0000182229 CCAGAACATCTGTGTGCGTTT pLKO.1 1978 CDS 100% 4.050 2.835 N Prmt5 n/a
14 TRCN0000292755 CCAGAACATCTGTGTGCGTTT pLKO_005 1978 CDS 100% 4.050 2.835 N Prmt5 n/a
15 TRCN0000182819 CAGCTCTGAGTTCTCTTCCTA pLKO.1 2137 3UTR 100% 3.000 2.100 N Prmt5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.