Transcript: Mouse NM_001313916.1

Mus musculus polo-like kinase 3 (Plk3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Plk3 (12795)
Length:
2434
CDS:
100..1995

Additional Resources:

NCBI RefSeq record:
NM_001313916.1
NBCI Gene record:
Plk3 (12795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000761 CAGCGCGAGAAGATCCTAAAT pLKO.1 409 CDS 100% 13.200 18.480 N PLK3 n/a
2 TRCN0000361270 GTATAGCCTACGCGGTCAAAG pLKO_005 356 CDS 100% 10.800 15.120 N Plk3 n/a
3 TRCN0000233490 TCAGCGCGAGAAGATCCTAAA pLKO_005 408 CDS 100% 10.800 15.120 N PLK3 n/a
4 TRCN0000361320 TCAGCGCGAGAAGATCCTAAA pLKO_005 408 CDS 100% 10.800 15.120 N Plk3 n/a
5 TRCN0000361220 TCGAGGATGCTGACAACATAT pLKO_005 488 CDS 100% 13.200 9.240 N Plk3 n/a
6 TRCN0000238787 GGGAATCAGGGACCAGCTTTA pLKO_005 2124 3UTR 100% 10.800 7.560 N PLK3 n/a
7 TRCN0000027596 GATGCTGACAACATATACATT pLKO.1 493 CDS 100% 5.625 3.938 N Plk3 n/a
8 TRCN0000027671 GCTGCATCAAGCAGGTTCATT pLKO.1 911 CDS 100% 5.625 3.938 N Plk3 n/a
9 TRCN0000027594 GTTGACTACTCCAACAAGTTT pLKO.1 1456 CDS 100% 5.625 3.938 N Plk3 n/a
10 TRCN0000027612 CACGGATAACATGGAACTGAA pLKO.1 681 CDS 100% 4.950 3.465 N Plk3 n/a
11 TRCN0000027628 CAAAGTTACCAAGAGCCTGTT pLKO.1 1137 CDS 100% 4.050 2.835 N Plk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488077 GTCTTAATTTTCTTGTACCTGACC pLX_317 14% 85.7% 91% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488464 TATCATAGACATATTACTACAACC pLX_317 14% 85.6% 90.9% V5 (many diffs) n/a
Download CSV