Transcript: Mouse NM_001313949.1

Mus musculus keratin 13 (Krt13), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Krt13 (16663)
Length:
1217
CDS:
269..928

Additional Resources:

NCBI RefSeq record:
NM_001313949.1
NBCI Gene record:
Krt13 (16663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430635 CAATTCCGGTCGCCCAGATTT pLKO_005 895 CDS 100% 13.200 18.480 N Krt13 n/a
2 TRCN0000432201 CTTCAACTCCGGAGGAAATAA pLKO_005 844 CDS 100% 15.000 10.500 N Krt13 n/a
3 TRCN0000419858 AGTATCCTCCAACGCTGAAAT pLKO_005 508 CDS 100% 13.200 9.240 N Krt13 n/a
4 TRCN0000091370 CCAGGAATACAAGATGCTGTT pLKO.1 745 CDS 100% 4.050 2.835 N Krt13 n/a
5 TRCN0000091371 GCAGAGAAGAATCGGAGGGAT pLKO.1 443 CDS 100% 2.640 1.848 N Krt13 n/a
6 TRCN0000091369 GCCTGAATGAAGAACTGGCTT pLKO.1 282 CDS 100% 2.640 1.848 N Krt13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06506 pDONR223 100% 41.6% 42.3% None (many diffs) n/a
2 ccsbBroad304_06506 pLX_304 0% 41.6% 42.3% V5 (many diffs) n/a
3 TRCN0000476017 TTGGATAGGGACAAACGGTCAACG pLX_317 28.8% 41.6% 42.3% V5 (many diffs) n/a
Download CSV