Transcript: Human NM_001313990.2

Homo sapiens insulin like growth factor binding protein 2 (IGFBP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
IGFBP2 (3485)
Length:
1048
CDS:
171..716

Additional Resources:

NCBI RefSeq record:
NM_001313990.2
NBCI Gene record:
IGFBP2 (3485)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006574 CCAGTTCTGACACACGTATTT pLKO.1 815 3UTR 100% 13.200 9.240 N IGFBP2 n/a
2 TRCN0000318717 CCAGTTCTGACACACGTATTT pLKO_005 815 3UTR 100% 13.200 9.240 N IGFBP2 n/a
3 TRCN0000006577 ACAGTGCAAGATGTCTCTGAA pLKO.1 548 CDS 100% 4.950 3.465 N IGFBP2 n/a
4 TRCN0000318716 ACAGTGCAAGATGTCTCTGAA pLKO_005 548 CDS 100% 4.950 3.465 N IGFBP2 n/a
5 TRCN0000006575 CAACCTCAAACAGTGCAAGAT pLKO.1 539 CDS 100% 4.950 3.465 N IGFBP2 n/a
6 TRCN0000318660 CAACCTCAAACAGTGCAAGAT pLKO_005 539 CDS 100% 4.950 3.465 N IGFBP2 n/a
7 TRCN0000006576 CGTGGACAGCACCATGAACAT pLKO.1 224 CDS 100% 4.950 3.465 N IGFBP2 n/a
8 TRCN0000318659 CGTGGACAGCACCATGAACAT pLKO_005 224 CDS 100% 4.950 3.465 N IGFBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488558 ATTCACAATAGGCGGCACCCTTGT pLX_317 33% 55.1% 53.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV