Transcript: Human NM_001314007.2

Homo sapiens diaphanous related formin 1 (DIAPH1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
DIAPH1 (1729)
Length:
5788
CDS:
87..3839

Additional Resources:

NCBI RefSeq record:
NM_001314007.2
NBCI Gene record:
DIAPH1 (1729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001314007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118681 GCATGCCCTATCAAGAGATTA pLKO.1 2689 CDS 100% 13.200 18.480 N DIAPH1 n/a
2 TRCN0000299579 GCATGCCCTATCAAGAGATTA pLKO_005 2689 CDS 100% 13.200 18.480 N DIAPH1 n/a
3 TRCN0000118680 CCCTATCAAGAGATTAAGAAT pLKO.1 2694 CDS 100% 5.625 7.875 N DIAPH1 n/a
4 TRCN0000303648 CTCTCCTGGCTGTGGTTATTT pLKO_005 4448 3UTR 100% 15.000 10.500 N DIAPH1 n/a
5 TRCN0000303715 GCCGCTGCTGGATGGATTAAA pLKO_005 974 CDS 100% 15.000 10.500 N DIAPH1 n/a
6 TRCN0000303713 AGATATGAGAGTGCAACTAAA pLKO_005 1154 CDS 100% 13.200 9.240 N DIAPH1 n/a
7 TRCN0000118678 GCCCAGAATCTCTCAATCTTT pLKO.1 2655 CDS 100% 5.625 3.938 N DIAPH1 n/a
8 TRCN0000299578 GCCCAGAATCTCTCAATCTTT pLKO_005 2655 CDS 100% 5.625 3.938 N DIAPH1 n/a
9 TRCN0000118679 GCCTCCTTATTGGACATTCTT pLKO.1 651 CDS 100% 5.625 3.938 N DIAPH1 n/a
10 TRCN0000118677 CCTGACTTTCTAATGGGCTTT pLKO.1 4300 3UTR 100% 4.050 2.835 N DIAPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465905 TAATCAAATAAGTATCCCCGATCA pLX_317 9.8% 94.4% 90.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV