Transcript: Human NM_001314020.2

Homo sapiens copine 5 (CPNE5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CPNE5 (57699)
Length:
2474
CDS:
250..981

Additional Resources:

NCBI RefSeq record:
NM_001314020.2
NBCI Gene record:
CPNE5 (57699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001314020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156257 CCCGGCAATCCTATTTGCTTA pLKO.1 1300 3UTR 100% 4.950 6.930 N CPNE5 n/a
2 TRCN0000156316 CCCATCCTACTCCTAACAGAT pLKO.1 2042 3UTR 100% 4.950 3.960 N CPNE5 n/a
3 TRCN0000152834 GCCAGGAAGGTGTAAACAATA pLKO.1 1251 3UTR 100% 13.200 9.240 N CPNE5 n/a
4 TRCN0000156862 GCCTCAGTTTCCATGTCTGTA pLKO.1 1939 3UTR 100% 4.950 2.970 N CPNE5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12396 pDONR223 100% 80.6% 80.7% None 0_1ins174;180T>C n/a
2 ccsbBroad304_12396 pLX_304 0% 80.6% 80.7% V5 0_1ins174;180T>C n/a
3 TRCN0000470806 GGGTAGCATGCGGCTCGGCCTCGC pLX_317 51.7% 80.6% 80.7% V5 0_1ins174;180T>C n/a
Download CSV