Construct: ORF TRCN0000470806
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008810.1_s317c1
- Derived from:
- ccsbBroadEn_12396
- DNA Barcode:
- GGGTAGCATGCGGCTCGGCCTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPNE5 (57699)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470806
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57699 | CPNE5 | copine 5 | NM_001314018.1 | 99.8% | 100% | 354T>C |
| 2 | human | 57699 | CPNE5 | copine 5 | NM_001314019.2 | 80.6% | 80.7% | 0_1ins174;180T>C |
| 3 | human | 57699 | CPNE5 | copine 5 | NM_001314020.2 | 80.6% | 80.7% | 0_1ins174;180T>C |
| 4 | human | 57699 | CPNE5 | copine 5 | XM_024446500.1 | 80.6% | 80.7% | 0_1ins174;180T>C |
| 5 | human | 57699 | CPNE5 | copine 5 | XM_011514775.2 | 74.9% | 66.4% | (many diffs) |
| 6 | human | 57699 | CPNE5 | copine 5 | XM_011514773.2 | 57.5% | 51.1% | (many diffs) |
| 7 | human | 57699 | CPNE5 | copine 5 | XM_017011139.2 | 52.2% | 46.4% | (many diffs) |
| 8 | human | 57699 | CPNE5 | copine 5 | NM_020939.2 | 50.7% | 50.7% | 1_876del;1230T>C |
| 9 | human | 57699 | CPNE5 | copine 5 | XM_005249247.2 | 49.2% | 49.3% | 1_927del;1281T>C |
| 10 | human | 57699 | CPNE5 | copine 5 | XM_011514770.1 | 43.3% | 38.5% | (many diffs) |
| 11 | human | 57699 | CPNE5 | copine 5 | XM_011514771.2 | 43.3% | 38.5% | (many diffs) |
| 12 | human | 57699 | CPNE5 | copine 5 | XM_011514769.1 | 41.9% | 37.2% | (many diffs) |
| 13 | human | 57699 | CPNE5 | copine 5 | XM_011514768.1 | 40.9% | 36.3% | (many diffs) |
| 14 | human | 57699 | CPNE5 | copine 5 | XM_011514772.1 | 35.6% | 33.1% | (many diffs) |
| 15 | human | 57699 | CPNE5 | copine 5 | XR_001743541.1 | 35.2% | (many diffs) | |
| 16 | human | 57699 | CPNE5 | copine 5 | XR_002956290.1 | 26% | (many diffs) | |
| 17 | human | 57699 | CPNE5 | copine 5 | XR_002956291.1 | 24.7% | (many diffs) | |
| 18 | mouse | 240058 | Cpne5 | copine V | XM_017317469.1 | 89.3% | 97% | (many diffs) |
| 19 | mouse | 240058 | Cpne5 | copine V | XM_017317468.1 | 71.6% | 78% | (many diffs) |
| 20 | mouse | 240058 | Cpne5 | copine V | XM_017317467.1 | 60.4% | 65.6% | (many diffs) |
| 21 | mouse | 240058 | Cpne5 | copine V | XM_006524251.1 | 58.2% | 63.2% | (many diffs) |
| 22 | mouse | 240058 | Cpne5 | copine V | NM_153166.2 | 45.3% | 49.2% | (many diffs) |
| 23 | mouse | 240058 | Cpne5 | copine V | XM_006524249.2 | 44% | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaaaaagaaa tacgtgaatt ctggcacagt caccctgctt tcctttgctg 121 tggagtcaga gtgcaccttc cttgactaca tcaaaggagg gacccagatc aacttcactg 181 tggccattga tttcactgcc tccaatggga acccctcaca gtccacatcc ctgcactaca 241 tgagccccta ccagctgaac gcctacgcgc tggcgctgac tgccgtcgga gagatcatcc 301 agcactacga cagtgacaag atgttccctg ccctgggctt cggggccaag ctgcccccgg 361 atggcagagt gtcccacgag ttcccactga atggcaacca ggagaacccc tcatgctgcg 421 gcatcgacgg catcctggag gcctaccacc gcagcctgcg cactgtgcag ctgtacggcc 481 ccaccaactt tgcccccgtg gTCACCCACG TGGCCAGGAA TGCAGCGGCC GTGCAGGATG 541 GCTCCCAGTA CTCGGTGCTG CTCATCATTA CTGATGGGGT CATCTCGGAC ATGGCGCAGA 601 CCAAGGAGGC CATTGTCAAC GCTGCCAAGC TCCCCATGTC CATCATTATC GTCGGCGTGG 661 GCCAGGCAGA GTTCGACGCC ATGGTGGAGC TGGATGGCGA CGACGTGCGG ATCTCCTCCC 721 GGGGGAAGCT GGCTGAACGC GACATCGTCC AGTTTGTACC CTTCCGGGAC TACGTGGACC 781 GCACAGGCAA CCACGTGCTG AGCATGGCCC GCCTGGCCCG AGACGTGCTG GCAGAGATCC 841 CTGACCAACT GGTGTCCTAC ATGAAGGCAC AGGGCATTCG CCCGCGTCCC CCACCCGCAG 901 CACCAACCCA CTCGCCCTCG CAGTCCCCAG CCCGCACGCC CCCTGCGTCC CCCCTGCACA 961 CGCACATCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGGGTAG CATGCGGCTC GGCCTCGCAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt