Transcript: Human NM_001314051.1

Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
ANGPT1 (284)
Length:
3549
CDS:
280..1176

Additional Resources:

NCBI RefSeq record:
NM_001314051.1
NBCI Gene record:
ANGPT1 (284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001314051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058639 GCTTGGTTACTCGTCAAACAT pLKO.1 341 CDS 100% 5.625 7.875 N ANGPT1 n/a
2 TRCN0000058640 CCCTCATGTTAACAGGAGGAT pLKO.1 998 CDS 100% 2.640 3.696 N ANGPT1 n/a
3 TRCN0000371307 CCAGCAATAAGTGGTAGTTAT pLKO_005 1282 3UTR 100% 13.200 10.560 N ANGPT1 n/a
4 TRCN0000058641 CGTTCCACAACTATGATGATT pLKO.1 1138 CDS 100% 5.625 4.500 N ANGPT1 n/a
5 TRCN0000371308 TGGAAATCCCTCCGGTGAATA pLKO_005 723 CDS 100% 13.200 9.240 N ANGPT1 n/a
6 TRCN0000058642 CCTTGTCAATCTTTGCACTAA pLKO.1 459 CDS 100% 4.950 3.465 N ANGPT1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 90 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 90 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10677 pDONR223 100% 49.3% 49.3% None 1_162del;205_207delGGT;607_894del n/a
2 ccsbBroad304_10677 pLX_304 0% 49.3% 49.3% V5 1_162del;205_207delGGT;607_894del n/a
3 TRCN0000475147 TCATGCGTAATGATATACTCGCGC pLX_317 98.2% 49.3% 49.3% V5 1_162del;205_207delGGT;607_894del n/a
Download CSV