Transcript: Human NM_001316307.2

Homo sapiens Rac family small GTPase 3 (RAC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-28
Taxon:
Homo sapiens (human)
Gene:
RAC3 (5881)
Length:
1042
CDS:
85..597

Additional Resources:

NCBI RefSeq record:
NM_001316307.2
NBCI Gene record:
RAC3 (5881)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047290 CAACTACTCTGCCAACGTGAT pLKO.1 198 CDS 100% 4.050 2.835 N RAC3 n/a
2 TRCN0000291685 CAACTACTCTGCCAACGTGAT pLKO_005 198 CDS 100% 4.050 2.835 N RAC3 n/a
3 TRCN0000047289 CTTCGAGAATGTTCGTGCCAA pLKO.1 351 CDS 100% 2.640 1.848 N RAC3 n/a
4 TRCN0000047292 TGACGTCTTTCTGATCTGCTT pLKO.1 309 CDS 100% 2.640 1.848 N RAC3 n/a
5 TRCN0000307769 TGACGTCTTTCTGATCTGCTT pLKO_005 309 CDS 100% 2.640 1.848 N RAC3 n/a
6 TRCN0000047291 GAAGAAGTGCACCGTCTTCTA pLKO.1 646 3UTR 100% 0.495 0.297 N RAC3 n/a
7 TRCN0000307770 GAAGAAGTGCACCGTCTTCTA pLKO_005 646 3UTR 100% 0.495 0.297 N RAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316307.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06833 pDONR223 100% 87% 81.7% None 16T>G;448_451delGGTG;510_511ins70 n/a
2 ccsbBroad304_06833 pLX_304 0% 87% 81.7% V5 16T>G;448_451delGGTG;510_511ins70 n/a
3 TRCN0000468968 GCGGTTAAACATGACAGCCCCCAT pLX_317 71.4% 87% 81.7% V5 16T>G;448_451delGGTG;510_511ins70 n/a
Download CSV