Transcript: Human NM_001316341.2

Homo sapiens proteasome 26S subunit, non-ATPase 12 (PSMD12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PSMD12 (5718)
Length:
4640
CDS:
520..1713

Additional Resources:

NCBI RefSeq record:
NM_001316341.2
NBCI Gene record:
PSMD12 (5718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293628 TATCGACATCCCGTATCTTAG pLKO_005 524 CDS 100% 10.800 15.120 N PSMD12 n/a
2 TRCN0000058061 CCTAGCTGTGAAGGATTACAT pLKO.1 921 CDS 100% 5.625 7.875 N PSMD12 n/a
3 TRCN0000058060 CCGAATAAGTGGTGACAAGAA pLKO.1 1206 CDS 100% 4.950 6.930 N PSMD12 n/a
4 TRCN0000058059 CCTTCCTATCAAACTTCGATT pLKO.1 693 CDS 100% 4.950 6.930 N PSMD12 n/a
5 TRCN0000286175 CCTTCCTATCAAACTTCGATT pLKO_005 693 CDS 100% 4.950 6.930 N PSMD12 n/a
6 TRCN0000058058 GCCAAGTATTATACTCGGATA pLKO.1 1441 CDS 100% 4.050 5.670 N PSMD12 n/a
7 TRCN0000293629 GACTGTTATAATGGTGTATAT pLKO_005 1763 3UTR 100% 13.200 9.240 N PSMD12 n/a
8 TRCN0000058062 GTAGACAGATTAGCAGGAATT pLKO.1 1558 CDS 100% 0.000 0.000 N PSMD12 n/a
9 TRCN0000286174 GTAGACAGATTAGCAGGAATT pLKO_005 1558 CDS 100% 0.000 0.000 N PSMD12 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3942 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3942 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01325 pDONR223 100% 87% 87% None 0_1ins177 n/a
2 ccsbBroad304_01325 pLX_304 0% 87% 87% V5 0_1ins177 n/a
3 TRCN0000473252 ATTTACGTGAGGTGCGGCCAACAC pLX_317 38.1% 87% 87% V5 0_1ins177 n/a
Download CSV