Transcript: Human NM_001316347.2

Homo sapiens reversion inducing cysteine rich protein with kazal motifs (RECK), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
RECK (8434)
Length:
1106
CDS:
87..749

Additional Resources:

NCBI RefSeq record:
NM_001316347.2
NBCI Gene record:
RECK (8434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073524 CGCCTCTATTAGTCCACAATT pLKO.1 647 CDS 100% 13.200 18.480 N RECK n/a
2 TRCN0000073525 GCGCCTCTATTAGTCCACAAT pLKO.1 646 CDS 100% 4.950 6.930 N RECK n/a
3 TRCN0000369961 TGTGAACAATTATACTCAATC pLKO_005 677 CDS 100% 10.800 7.560 N RECK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11272 pDONR223 100% 93.4% 93.3% None (many diffs) n/a
2 ccsbBroad304_11272 pLX_304 0% 93.4% 93.3% V5 (many diffs) n/a
3 TRCN0000465287 CCCACCGCCAACCTTGGGCGTTCT pLX_317 50.9% 93.4% 93.3% V5 (many diffs) n/a
Download CSV