Construct: ORF TRCN0000465287
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017217.1_s317c1
- Derived from:
- ccsbBroadEn_11272
- DNA Barcode:
- CCCACCGCCAACCTTGGGCGTTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RECK (8434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465287
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8434 | RECK | reversion inducing cysteine... | NM_001316348.1 | 99.7% | 99.1% | 38T>C;55G>A |
| 2 | human | 8434 | RECK | reversion inducing cysteine... | NM_001316347.2 | 93.4% | 93.3% | (many diffs) |
| 3 | human | 8434 | RECK | reversion inducing cysteine... | NM_001316346.2 | 88.3% | 85.4% | (many diffs) |
| 4 | human | 8434 | RECK | reversion inducing cysteine... | XM_017015211.2 | 31.2% | 29.4% | (many diffs) |
| 5 | human | 8434 | RECK | reversion inducing cysteine... | NM_021111.3 | 22.7% | 21.4% | (many diffs) |
| 6 | human | 8434 | RECK | reversion inducing cysteine... | XM_017015207.1 | 18.2% | 16.3% | (many diffs) |
| 7 | human | 8434 | RECK | reversion inducing cysteine... | NM_001316345.2 | 9.4% | 8% | (many diffs) |
| 8 | human | 8434 | RECK | reversion inducing cysteine... | XM_017015208.1 | 9.4% | 8% | (many diffs) |
| 9 | human | 8434 | RECK | reversion inducing cysteine... | XM_017015209.1 | 9.4% | 8% | (many diffs) |
| 10 | human | 8434 | RECK | reversion inducing cysteine... | XM_017015210.1 | 9.4% | 8% | (many diffs) |
| 11 | mouse | 53614 | Reck | reversion-inducing-cysteine... | NM_016678.2 | 20.8% | 20.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 741
- ORF length:
- 675
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaccgtccgg gcctctctgc gaggtgcgct gccccttctg ctggccgtga 121 cgggggtcgc ggaggtggca gggggcctgg ctccgggcag tgcgggtgca ttgtgttgta 181 atcattcaaa ggataaccaa atgtgccgtg atgtatgtga acagattttc tcctcaaaaa 241 gtgaatcccg actaaaacat ctgttgcagc gagccccaga ttattgccca gagacaatgg 301 ttgaaatttg gaattgtatg aattcatctt tgccaggtgt gtttaagaag tctgatggct 361 gggttggctt aggctgctgt gaactggcta ttgccttGGA GTGTCGACAG GCATGCAAGC 421 AGGCATCTTC AAAGAATGAT ATTTCCAAAG TTTGCAGAAA AGAATATGAG AATGCTCTTT 481 TCAGTTGCAT TAGCAGAAAT GAAATGGGCT CGGTTTGTTG CAGTTATGCA GGTCATCACA 541 CAAACTGCCG AGAATACTGT CAAGCCATTT TTCGAACAGA CTCTTCTCCT GGTCCATCTC 601 AGATAAAAGC AGTGGAAAAT TATTGCGCCT CTATTAGTCC ACAATTAATA CATTGTGTGA 661 ACAATTATAC TCAATCTTAT CCAATGAGGA ACCCAACGGA TATGTTTGAA TTTTTTGCCA 721 ATGAGCAATT ATTACTTTTG TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 781 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 841 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCCA CCGCCAACCT 901 TGGGCGTTCT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt