Transcript: Mouse NM_001316360.1

Mus musculus bone morphogenetic protein 4 (Bmp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Bmp4 (12159)
Length:
1934
CDS:
374..1600

Additional Resources:

NCBI RefSeq record:
NM_001316360.1
NBCI Gene record:
Bmp4 (12159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340256 GGATTACATGAGGGATCTTTA pLKO_005 613 CDS 100% 13.200 18.480 N Bmp4 n/a
2 TRCN0000025922 GCGACACTTCTACAGATGTTT pLKO.1 548 CDS 100% 5.625 7.875 N Bmp4 n/a
3 TRCN0000059145 GCGAGCCATGCTAGTTTGATA pLKO.1 434 CDS 100% 5.625 7.875 N BMP4 n/a
4 TRCN0000025936 CCGGATTACATGAGGGATCTT pLKO.1 611 CDS 100% 4.950 6.930 N Bmp4 n/a
5 TRCN0000025957 CCATTCACTATACGTGGACTT pLKO.1 1303 CDS 100% 4.050 5.670 N Bmp4 n/a
6 TRCN0000340188 CCATTCACTATACGTGGACTT pLKO_005 1303 CDS 100% 4.050 5.670 N Bmp4 n/a
7 TRCN0000025875 CCCTAGTCAACTCTGTTAATT pLKO.1 1449 CDS 100% 15.000 12.000 N Bmp4 n/a
8 TRCN0000340189 CCCTAGTCAACTCTGTTAATT pLKO_005 1449 CDS 100% 15.000 12.000 N Bmp4 n/a
9 TRCN0000340191 ACAGGGCTTCCACCGTATAAA pLKO_005 892 CDS 100% 15.000 10.500 N Bmp4 n/a
10 TRCN0000340254 CATTCAACCACCTACACATAC pLKO_005 1680 3UTR 100% 10.800 7.560 N Bmp4 n/a
11 TRCN0000025905 CCATGATTCCTGGTAACCGAA pLKO.1 372 5UTR 100% 2.640 1.848 N Bmp4 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1624 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05899 pDONR223 100% 92.1% 96.8% None (many diffs) n/a
2 ccsbBroad304_05899 pLX_304 0% 92.1% 96.8% V5 (many diffs) n/a
3 TRCN0000466014 TCCGATCGTACTGATTTAATAAAT pLX_317 27.5% 92.1% 96.8% V5 (many diffs) n/a
Download CSV