Transcript: Mouse NM_001316748.1

Mus musculus tetraspanin 14 (Tspan14), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tspan14 (52588)
Length:
2521
CDS:
61..873

Additional Resources:

NCBI RefSeq record:
NM_001316748.1
NBCI Gene record:
Tspan14 (52588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381566 ACCTGCTCTTCAGCTACAATA pLKO_005 110 CDS 100% 13.200 9.240 N Tspan14 n/a
2 TRCN0000381356 AGTGGGATGAGTTCATCTTTA pLKO_005 692 CDS 100% 13.200 9.240 N Tspan14 n/a
3 TRCN0000094935 CCTCATTGACTCCCTTCAGAA pLKO.1 486 CDS 100% 4.950 3.465 N Tspan14 n/a
4 TRCN0000354216 CCTCATTGACTCCCTTCAGAA pLKO_005 486 CDS 100% 4.950 3.465 N Tspan14 n/a
5 TRCN0000094937 GCCCAGGAACATCTACATTGT pLKO.1 747 CDS 100% 4.950 3.465 N Tspan14 n/a
6 TRCN0000326778 GCCCAGGAACATCTACATTGT pLKO_005 747 CDS 100% 4.950 3.465 N Tspan14 n/a
7 TRCN0000094934 GCCTCGTTTCTCCATAGCATT pLKO.1 1504 3UTR 100% 4.950 3.465 N Tspan14 n/a
8 TRCN0000326841 GCCTCGTTTCTCCATAGCATT pLKO_005 1504 3UTR 100% 4.950 3.465 N Tspan14 n/a
9 TRCN0000094936 CTGGTACAAGTACCTGCTCTT pLKO.1 99 CDS 100% 4.050 2.835 N Tspan14 n/a
10 TRCN0000158032 CGAGAGCAACATCAAGTCCTA pLKO.1 441 CDS 100% 2.640 1.848 N TSPAN14 n/a
11 TRCN0000349652 CGAGAGCAACATCAAGTCCTA pLKO_005 441 CDS 100% 2.640 1.848 N TSPAN14 n/a
12 TRCN0000094938 TGTGGCTATGATGTCCGGATT pLKO.1 658 CDS 100% 4.050 2.430 N Tspan14 n/a
13 TRCN0000326779 TGTGGCTATGATGTCCGGATT pLKO_005 658 CDS 100% 4.050 2.430 N Tspan14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12726 pDONR223 100% 84.4% 91.1% None (many diffs) n/a
2 TRCN0000473275 GATGACACGCCCCAAGTCGGGAAG pLX_317 72% 84.4% 91.1% V5 (many diffs) n/a
Download CSV