Transcript: Human NM_001316772.1

Homo sapiens glycyl-tRNA synthetase 1 (GARS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
GARS1 (2617)
Length:
2590
CDS:
350..2407

Additional Resources:

NCBI RefSeq record:
NM_001316772.1
NBCI Gene record:
GARS1 (2617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045796 CGTGACTCAATGCGGCAGATA pLKO.1 2252 CDS 100% 4.950 6.930 N GARS1 n/a
2 TRCN0000291015 CGTGACTCAATGCGGCAGATA pLKO_005 2252 CDS 100% 4.950 6.930 N GARS1 n/a
3 TRCN0000045797 CAGCCCAAAGATGATATTGTA pLKO.1 524 CDS 100% 5.625 4.500 N GARS1 n/a
4 TRCN0000291011 CAGCCCAAAGATGATATTGTA pLKO_005 524 CDS 100% 5.625 4.500 N GARS1 n/a
5 TRCN0000045795 GAACCCAGTAAGGGAGCAATT pLKO.1 1679 CDS 100% 10.800 7.560 N GARS1 n/a
6 TRCN0000291012 GAACCCAGTAAGGGAGCAATT pLKO_005 1679 CDS 100% 10.800 7.560 N GARS1 n/a
7 TRCN0000045793 GCTGTTGAACAGGGTGTGATT pLKO.1 1370 CDS 100% 4.950 3.465 N GARS1 n/a
8 TRCN0000291014 GCTGTTGAACAGGGTGTGATT pLKO_005 1370 CDS 100% 4.950 3.465 N GARS1 n/a
9 TRCN0000045794 GCTGTGCTTTGAAGAACAATA pLKO.1 648 CDS 100% 13.200 7.920 N GARS1 n/a
10 TRCN0000291013 GCTGTGCTTTGAAGAACAATA pLKO_005 648 CDS 100% 13.200 7.920 N GARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316772.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10837 pDONR223 100% 91.2% 90.5% None 0_1ins162;2034_2035insA;2055_2056ins35 n/a
2 ccsbBroad304_10837 pLX_304 0% 91.2% 90.5% V5 0_1ins162;2034_2035insA;2055_2056ins35 n/a
Download CSV