Transcript: Human NM_001316935.1

Homo sapiens heat shock protein family B (small) member 11 (HSPB11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-06
Taxon:
Homo sapiens (human)
Gene:
HSPB11 (51668)
Length:
612
CDS:
88..522

Additional Resources:

NCBI RefSeq record:
NM_001316935.1
NBCI Gene record:
HSPB11 (51668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072367 TGGCACATGATGGCTCCGCTA pLKO.1 404 CDS 100% 0.720 1.008 N HSPB11 n/a
2 TRCN0000072363 CGTCTAAAGAGCCAGTTGATT pLKO.1 320 CDS 100% 5.625 3.938 N HSPB11 n/a
3 TRCN0000299918 CGTCTAAAGAGCCAGTTGATT pLKO_005 320 CDS 100% 5.625 3.938 N HSPB11 n/a
4 TRCN0000072364 GCTTGTAATCCAAAGTTACTT pLKO.1 270 CDS 100% 5.625 3.938 N HSPB11 n/a
5 TRCN0000299983 GCTTGTAATCCAAAGTTACTT pLKO_005 270 CDS 100% 5.625 3.938 N HSPB11 n/a
6 TRCN0000072365 GTACAGACCTTGAAGATTGAA pLKO.1 292 CDS 100% 5.625 3.938 N HSPB11 n/a
7 TRCN0000299919 GTACAGACCTTGAAGATTGAA pLKO_005 292 CDS 100% 5.625 3.938 N HSPB11 n/a
8 TRCN0000072366 GATGGGAATCCAGAAACGTTT pLKO.1 181 CDS 100% 4.950 3.465 N HSPB11 n/a
9 TRCN0000299982 GATGGGAATCCAGAAACGTTT pLKO_005 181 CDS 100% 4.950 3.465 N HSPB11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316935.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08336 pDONR223 100% 99.7% 99.3% None 5G>T n/a
2 ccsbBroad304_08336 pLX_304 0% 99.7% 99.3% V5 5G>T n/a
3 TRCN0000471953 CAGTGCCAATTCCCTCCAACCACC pLX_317 92% 99.7% 99.3% V5 5G>T n/a
Download CSV