Transcript: Human NM_001316963.2

Homo sapiens betacellulin (BTC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
BTC (685)
Length:
2506
CDS:
199..588

Additional Resources:

NCBI RefSeq record:
NM_001316963.2
NBCI Gene record:
BTC (685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117973 CCTCTTCGGAAACGTCGTAAA pLKO.1 481 CDS 100% 10.800 15.120 N BTC n/a
2 TRCN0000117976 GCCCTGGGTCTAGTGATCCTT pLKO.1 256 CDS 100% 1.000 0.800 N BTC n/a
3 TRCN0000117972 CCAGGATTACTAGTCAAACAA pLKO.1 857 3UTR 100% 0.000 0.000 N BTC n/a
4 TRCN0000371375 GCAACAACAGAAGGGAAATTT pLKO_005 809 3UTR 100% 15.000 10.500 N BTC n/a
5 TRCN0000371376 CTCCTATCAATGAAGATATTG pLKO_005 548 CDS 100% 13.200 9.240 N BTC n/a
6 TRCN0000371434 GCTACCACCACACAATCAAAG pLKO_005 361 CDS 100% 10.800 7.560 N BTC n/a
7 TRCN0000117974 CCACCAGAAGTCCTGAAACTA pLKO.1 302 CDS 100% 5.625 3.938 N BTC n/a
8 TRCN0000117975 GCAATACAAGCATTACTGCAT pLKO.1 411 CDS 100% 2.640 1.848 N BTC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05906 pDONR223 100% 72.4% 72.4% None 281_282ins147 n/a
2 ccsbBroad304_05906 pLX_304 0% 72.4% 72.4% V5 281_282ins147 n/a
3 TRCN0000467801 ACTTGGTTAAGTTCGTTCAGCCCG pLX_317 71.8% 72.4% 72.4% V5 281_282ins147 n/a
Download CSV