Transcript: Human NM_001316964.2

Homo sapiens receptor accessory protein 4 (REEP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
REEP4 (80346)
Length:
1511
CDS:
426..1181

Additional Resources:

NCBI RefSeq record:
NM_001316964.2
NBCI Gene record:
REEP4 (80346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316964.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063392 CCTGAAGGTTCGGACGAGGAA pLKO.1 993 CDS 100% 0.880 1.232 N REEP4 n/a
2 TRCN0000418038 TCCAGCTTATGCTTCCTATAA pLKO_005 479 CDS 100% 13.200 10.560 N REEP4 n/a
3 TRCN0000063390 GACCAAGAACATTCGTGAATA pLKO.1 509 CDS 100% 13.200 9.240 N REEP4 n/a
4 TRCN0000428004 TGACTCCTGCTGATGGTTAAG pLKO_005 1162 CDS 100% 10.800 7.560 N REEP4 n/a
5 TRCN0000063388 GCAGAGATCGTTACAGACATT pLKO.1 576 CDS 100% 4.950 3.465 N REEP4 n/a
6 TRCN0000174117 GCAGAGATCGTTACAGACATT pLKO.1 576 CDS 100% 4.950 3.465 N REEP4 n/a
7 TRCN0000063391 AGCCTGCTTTACCGCAAGTTT pLKO.1 678 CDS 100% 5.625 3.375 N REEP4 n/a
8 TRCN0000063389 CCCTTTCTACTATGAGATCAA pLKO.1 611 CDS 100% 4.950 2.970 N REEP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316964.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04213 pDONR223 100% 67.8% 75% None 552_553ins155;617_753del n/a
2 ccsbBroad304_04213 pLX_304 0% 67.8% 75% V5 552_553ins155;617_753del n/a
3 TRCN0000467308 TAGACCTGTTCCCTTGTCGCGGCA pLX_317 49.5% 67.8% 75% V5 552_553ins155;617_753del n/a
Download CSV