Transcript: Human NM_001317003.1

Homo sapiens LY6/PLAUR domain containing 6B (LYPD6B), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-09-24
Taxon:
Homo sapiens (human)
Gene:
LYPD6B (130576)
Length:
1528
CDS:
402..953

Additional Resources:

NCBI RefSeq record:
NM_001317003.1
NBCI Gene record:
LYPD6B (130576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164602 CCAGTGGTTTGCTTGGATAAA pLKO.1 1085 3UTR 100% 13.200 9.240 N LYPD6B n/a
2 TRCN0000429662 CTCTGTCACGCTCTCGCTATA pLKO_005 453 CDS 100% 10.800 7.560 N LYPD6B n/a
3 TRCN0000166404 CCTGAGAAGATGGTCTGACTT pLKO.1 1153 3UTR 100% 4.950 3.465 N LYPD6B n/a
4 TRCN0000166685 CTGGGTCTTTGTGCTTCCATT pLKO.1 926 CDS 100% 4.950 3.465 N LYPD6B n/a
5 TRCN0000163217 GAAGACAAATGGTGTCCACAA pLKO.1 636 CDS 100% 4.050 2.835 N LYPD6B n/a
6 TRCN0000164910 GCTGTGAAGGAATGATCTGCA pLKO.1 802 CDS 100% 2.640 1.848 N LYPD6B n/a
7 TRCN0000415206 ACTTTGGAGTGAAGATCAATC pLKO_005 1022 3UTR 100% 10.800 6.480 N LYPD6B n/a
8 TRCN0000162314 CAGATCGTTATCTTCTCAGAA pLKO.1 483 CDS 100% 4.950 2.970 N LYPD6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13155 pDONR223 100% 76.5% 73.7% None 1_42del;448delA;464_549del n/a
2 ccsbBroad304_13155 pLX_304 0% 76.5% 73.7% V5 1_42del;448delA;464_549del n/a
Download CSV