Transcript: Human NM_001317040.1

Homo sapiens galactosidase beta 1 (GLB1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
GLB1 (2720)
Length:
2779
CDS:
146..2323

Additional Resources:

NCBI RefSeq record:
NM_001317040.1
NBCI Gene record:
GLB1 (2720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083276 GTGTGAACTATGGTGCATATA pLKO.1 1734 CDS 100% 13.200 18.480 N GLB1 n/a
2 TRCN0000083274 CGTGTGAACTATGGTGCATAT pLKO.1 1733 CDS 100% 10.800 15.120 N GLB1 n/a
3 TRCN0000301018 CGTGTGAACTATGGTGCATAT pLKO_005 1733 CDS 100% 10.800 15.120 N GLB1 n/a
4 TRCN0000083273 CCCTGAACATACCTCACAGAT pLKO.1 2355 3UTR 100% 4.950 3.465 N GLB1 n/a
5 TRCN0000301083 CCCTGAACATACCTCACAGAT pLKO_005 2355 3UTR 100% 4.950 3.465 N GLB1 n/a
6 TRCN0000083277 CGCTACATCTCAGGAAGCATT pLKO.1 434 CDS 100% 4.950 3.465 N GLB1 n/a
7 TRCN0000331464 CGCTACATCTCAGGAAGCATT pLKO_005 434 CDS 100% 4.950 3.465 N GLB1 n/a
8 TRCN0000083275 GCAGCTACTTTGCCTGTGATT pLKO.1 858 CDS 100% 4.950 3.465 N GLB1 n/a
9 TRCN0000301007 GCAGCTACTTTGCCTGTGATT pLKO_005 858 CDS 100% 4.950 3.465 N GLB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06281 pDONR223 100% 93.2% 93.2% None 29C>T;34T>C;76_219del n/a
2 ccsbBroad304_06281 pLX_304 0% 93.2% 93.2% V5 29C>T;34T>C;76_219del n/a
3 TRCN0000481640 AGCCCCATATTGGCCGGGGCCCCT pLX_317 24.6% 93.2% 93.2% V5 29C>T;34T>C;76_219del n/a
Download CSV