Transcript: Human NM_001317734.2

Homo sapiens PBX homeobox interacting protein 1 (PBXIP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PBXIP1 (57326)
Length:
3118
CDS:
66..2174

Additional Resources:

NCBI RefSeq record:
NM_001317734.2
NBCI Gene record:
PBXIP1 (57326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232298 AGCCCAAGATCCCAGCGTTAT pLKO_005 2211 3UTR 100% 10.800 7.560 N PBXIP1 n/a
2 TRCN0000232297 AGGCATTAAGGCAAGAGTTAG pLKO_005 1153 CDS 100% 10.800 7.560 N PBXIP1 n/a
3 TRCN0000232296 TCAGTCTGGCAGCATTCTAAC pLKO_005 182 CDS 100% 10.800 7.560 N PBXIP1 n/a
4 TRCN0000015073 CAGGCATTAAGGCAAGAGTTA pLKO.1 1152 CDS 100% 4.950 3.465 N PBXIP1 n/a
5 TRCN0000015074 GATGATGAAGTAGATGACTTT pLKO.1 2010 CDS 100% 4.950 3.465 N PBXIP1 n/a
6 TRCN0000015076 CCTGACTTTCTTTGGCACAGA pLKO.1 1775 CDS 100% 2.640 1.848 N PBXIP1 n/a
7 TRCN0000015077 GAAAGAATTAGCTGGGACCAT pLKO.1 125 CDS 100% 2.640 1.848 N PBXIP1 n/a
8 TRCN0000015075 GCTGGGCATCTCCCTCAACAT pLKO.1 548 CDS 100% 1.650 1.155 N PBXIP1 n/a
9 TRCN0000257293 GGCTGAGCACTGGAAACATAA pLKO_005 1436 CDS 100% 13.200 7.920 N PBXIP1 n/a
10 TRCN0000257273 GACGCTCTTCCAGACTGAAAG pLKO_005 158 CDS 100% 10.800 6.480 N PBXIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03812 pDONR223 100% 96% 96% None 0_1ins87 n/a
2 ccsbBroad304_03812 pLX_304 0% 96% 96% V5 0_1ins87 n/a
3 TRCN0000480752 TGCGCTGAATAGTTGAGGCTCACA pLX_317 19.8% 96% 96% V5 0_1ins87 n/a
Download CSV