Transcript: Human NM_001317782.2

Homo sapiens ribosomal protein L8 (RPL8), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
RPL8 (6132)
Length:
1070
CDS:
262..1035

Additional Resources:

NCBI RefSeq record:
NM_001317782.2
NBCI Gene record:
RPL8 (6132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117467 CCAGTTTGTGTATTGCGGCAA pLKO.1 516 CDS 100% 2.160 3.024 N RPL8 n/a
2 TRCN0000299969 CCAGTTTGTGTATTGCGGCAA pLKO_005 516 CDS 100% 2.160 3.024 N RPL8 n/a
3 TRCN0000117470 GCGTACCACAAATATAAGGCA pLKO.1 814 CDS 100% 0.750 1.050 N RPL8 n/a
4 TRCN0000299970 GCGTACCACAAATATAAGGCA pLKO_005 814 CDS 100% 0.750 1.050 N RPL8 n/a
5 TRCN0000117471 AGGGAACTATGCCACCGTTAT pLKO.1 651 CDS 100% 10.800 8.640 N RPL8 n/a
6 TRCN0000331217 AGGGAACTATGCCACCGTTAT pLKO_005 651 CDS 100% 10.800 8.640 N RPL8 n/a
7 TRCN0000117468 CCGAATTGACAAACCCATCTT pLKO.1 780 CDS 100% 4.950 3.960 N RPL8 n/a
8 TRCN0000299910 CCGAATTGACAAACCCATCTT pLKO_005 780 CDS 100% 4.950 3.960 N RPL8 n/a
9 TRCN0000117469 CGTACCACAAATATAAGGCAA pLKO.1 815 CDS 100% 2.640 1.848 N RPL8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01419 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01419 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469295 CTTAGACTATGTCAGTCCCACAGT pLX_317 58% 100% 100% V5 n/a
4 ccsbBroadEn_06876 pDONR223 100% 99.8% 99.6% None 292A>G n/a
5 ccsbBroad304_06876 pLX_304 0% 99.8% 99.6% V5 292A>G n/a
6 TRCN0000469333 AGCTTTGTATACAGGCAGATAGGT pLX_317 61.6% 99.8% 99.6% V5 292A>G n/a
Download CSV