Transcript: Human NM_001317800.2

Homo sapiens docking protein 2 (DOK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DOK2 (9046)
Length:
1396
CDS:
182..958

Additional Resources:

NCBI RefSeq record:
NM_001317800.2
NBCI Gene record:
DOK2 (9046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166368 CGACCTGACCACATATACGAT pLKO.1 737 CDS 100% 3.000 4.200 N DOK2 n/a
2 TRCN0000165539 GCTGATAAATTGCCTCTCCCA pLKO.1 1082 3UTR 100% 0.660 0.924 N DOK2 n/a
3 TRCN0000164202 CCAGGAACTGAGTATGACAAT pLKO.1 911 CDS 100% 4.950 3.465 N DOK2 n/a
4 TRCN0000160872 GAACTGAGTATGACAATGTTG pLKO.1 915 CDS 100% 4.950 3.465 N DOK2 n/a
5 TRCN0000164642 GCAAGGCAATGAGATCTTCTT pLKO.1 406 CDS 100% 4.950 3.465 N DOK2 n/a
6 TRCN0000165937 GCCAGGAACTGAGTATGACAA pLKO.1 910 CDS 100% 4.950 3.465 N DOK2 n/a
7 TRCN0000165149 GCTTCCTGCACCTTTCAGATT pLKO.1 1346 3UTR 100% 4.950 3.465 N DOK2 n/a
8 TRCN0000165816 GTGACCATGAGACCTACAGAA pLKO.1 176 5UTR 100% 4.950 3.465 N DOK2 n/a
9 TRCN0000162906 GAATTTGCTGTGACCATGAGA pLKO.1 167 5UTR 100% 3.000 2.100 N DOK2 n/a
10 TRCN0000165885 GAGGGCAACTTTGAGTTCGAA pLKO.1 380 CDS 100% 3.000 2.100 N DOK2 n/a
11 TRCN0000162773 CAAGGAATTTGCTGTGACCAT pLKO.1 163 5UTR 100% 2.640 1.848 N DOK2 n/a
12 TRCN0000164297 CTTCTTGTATCTTCAGCAGCA pLKO.1 116 5UTR 100% 2.160 1.512 N DOK2 n/a
13 TRCN0000163668 GTTGTACTAAAGAAAGGCCCA pLKO.1 932 CDS 100% 0.540 0.378 N DOK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07346 pDONR223 100% 62.4% 62.6% None 0_1ins462;324G>C;699C>T n/a
2 ccsbBroad304_07346 pLX_304 0% 62.4% 62.6% V5 0_1ins462;324G>C;699C>T n/a
3 TRCN0000466030 CGAGTTCAGCGGCGGGAATCTAAT pLX_317 30.5% 62.4% 62.6% V5 0_1ins462;324G>C;699C>T n/a
Download CSV