Transcript: Human NM_001317808.1

Homo sapiens leucine rich repeat containing 3B (LRRC3B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
LRRC3B (116135)
Length:
1441
CDS:
326..1105

Additional Resources:

NCBI RefSeq record:
NM_001317808.1
NBCI Gene record:
LRRC3B (116135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161222 GACCTTTGTAACCTCCCTAAA pLKO.1 902 CDS 100% 10.800 15.120 N LRRC3B n/a
2 TRCN0000431246 GTCCGACAATCGGATTCAAAG pLKO_005 685 CDS 100% 10.800 15.120 N LRRC3B n/a
3 TRCN0000430035 TCCAATCAGATCACATCTATT pLKO_005 542 CDS 100% 13.200 9.240 N LRRC3B n/a
4 TRCN0000432475 ATGTTTGGCTGGTTCACTATG pLKO_005 953 CDS 100% 10.800 7.560 N LRRC3B n/a
5 TRCN0000158863 GCAGTAGAAATAAGTGGTTTA pLKO.1 1153 3UTR 100% 10.800 7.560 N LRRC3B n/a
6 TRCN0000160914 GTCACCTGTAGCAATGCAAAT pLKO.1 467 CDS 100% 10.800 7.560 N LRRC3B n/a
7 TRCN0000160613 CTGACTGTCATTGAGAAAGAA pLKO.1 1114 3UTR 100% 5.625 3.938 N LRRC3B n/a
8 TRCN0000160392 CTTATGATACTGTGCTTTCAT pLKO.1 392 CDS 100% 5.625 3.938 N LRRC3B n/a
9 TRCN0000160168 CCTGAAACAGTCTTACTGTAT pLKO.1 515 CDS 100% 4.950 3.465 N LRRC3B n/a
10 TRCN0000160855 GACTGTACTCTACAGCAAGTT pLKO.1 773 CDS 100% 4.950 3.465 N LRRC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04694 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04694 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472627 CGCACGTTAAAGCATAACTCTCAC pLX_317 58.5% 100% 100% V5 n/a
Download CSV