Transcript: Human NM_001317838.2

Homo sapiens transmembrane protein 155 (TMEM155), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-03-12
Taxon:
Homo sapiens (human)
Gene:
TMEM155 (132332)
Length:
2157
CDS:
401..793

Additional Resources:

NCBI RefSeq record:
NM_001317838.2
NBCI Gene record:
TMEM155 (132332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242556 ATGGCAAGGTGCCAGGATTTG pLKO_005 554 CDS 100% 10.800 15.120 N TMEM155 n/a
2 TRCN0000242558 CACCTTCCTAGTGACTATTAT pLKO_005 1952 3UTR 100% 15.000 12.000 N TMEM155 n/a
3 TRCN0000242560 CTACTGCTATCTGCAAGATTG pLKO_005 768 CDS 100% 10.800 8.640 N TMEM155 n/a
4 TRCN0000242559 GCTTCCTCAGCAGCCCAATAA pLKO_005 708 CDS 100% 13.200 9.240 N TMEM155 n/a
5 TRCN0000167862 GATTCTACAGAATAAGAGAGA pLKO.1 493 CDS 100% 2.640 1.848 N TMEM155 n/a
6 TRCN0000172591 GCATGCCAGTTCAAATCCACT pLKO.1 675 CDS 100% 2.640 1.848 N TMEM155 n/a
7 TRCN0000242557 TCTTGGCTGTTGCACTAATTT pLKO_005 426 CDS 100% 15.000 9.000 N TMEM155 n/a
8 TRCN0000093079 GATGAAGAAGAAGATGATGAT pLKO.1 853 3UTR 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09539 pDONR223 100% 99.7% 99.2% None 32C>T n/a
2 ccsbBroad304_09539 pLX_304 0% 99.7% 99.2% V5 32C>T n/a
3 TRCN0000477250 AGTATGAAGCATACAAAAATTTCT pLX_317 91% 99.7% 99.2% V5 32C>T n/a
Download CSV