Transcript: Human NM_001317860.1

Homo sapiens Opa interacting protein 5 (OIP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
OIP5 (11339)
Length:
1126
CDS:
61..627

Additional Resources:

NCBI RefSeq record:
NM_001317860.1
NBCI Gene record:
OIP5 (11339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074085 GCTAACGCACAATCGCTTAAA pLKO.1 549 CDS 100% 13.200 18.480 N OIP5 n/a
2 TRCN0000307730 GCTAACGCACAATCGCTTAAA pLKO_005 549 CDS 100% 13.200 18.480 N OIP5 n/a
3 TRCN0000074087 GAGTTACAAATAACGTCGTTT pLKO.1 383 CDS 100% 4.950 6.930 N OIP5 n/a
4 TRCN0000291618 GAGTTACAAATAACGTCGTTT pLKO_005 383 CDS 100% 4.950 6.930 N OIP5 n/a
5 TRCN0000074083 CCATGTGTCCTCTGATCTAAA pLKO.1 928 3UTR 100% 13.200 9.240 N OIP5 n/a
6 TRCN0000291619 CCATGTGTCCTCTGATCTAAA pLKO_005 928 3UTR 100% 13.200 9.240 N OIP5 n/a
7 TRCN0000074086 GCATCAGAGATGGATATTCAA pLKO.1 481 CDS 100% 5.625 3.938 N OIP5 n/a
8 TRCN0000307732 GCATCAGAGATGGATATTCAA pLKO_005 481 CDS 100% 5.625 3.938 N OIP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02680 pDONR223 100% 82% 82% None 388_389ins123 n/a
2 ccsbBroad304_02680 pLX_304 0% 82% 82% V5 388_389ins123 n/a
3 TRCN0000469661 CGGCCTGAATTTAAGGTTTGGTGC pLX_317 54.4% 82% 82% V5 388_389ins123 n/a
Download CSV